Газель баня: Автобаня. Баня на Колесах. Газель купить в Москве | Транспорт

Содержание

Главная — Готовая садовая баня Емеля.

Компактная, готовая авторская баня на дачу.

Садовая баня «Емеля».

     Садовая баня «Емеля» поставляется  заказчику  полостью  собранной  и  готовой  к  эксплуатации.  Внутри  смонтирована  система  водопровода  с  бойлером  для  нагрева  воды. Установлена  душевая  кабина.  Разведено  электрическое  освещение.  Парильное  отделение  отделано  осиновой  вагонкой,  которая  не  боится  влажности  и  высоких  температур. Уникальная  арочная  конструкция  потолка  способствует  прекрасному  парораспределению  внутри  парилки.  Компактный размер  бани «Емеля»   позволяет  экономить  дрова  и  быстро  прогревать  парилку.  Огнезащита  печки  и  дымохода  выполнено  из   современного инновационного  материала. Утепление  бани  выполнено  в  полном   соответствии  с  современными  нормами.  Пароизоляционная  мембрана, утеплитель, алюминиевая  фольга.  Это  позволяет  эксплуатировать  баню  круглый год.  

 

Готовая баня Емеля

 

Готовая  баня  для  дачи  должна  соответствовать  ряду  требований, которые  мы  сформулировали исходя из пожеланий заказчиков  и воплотили  в  проекте  «Садовая баня «Емеля».

 

1.       Мобильность  и  легкость  в  установке. Готовая баня «Емеля»  перевозится  маленьким  манипулятором.  Для доставки сборной бани используется ГАЗель.          Сборка на участке занимает 4 — 5 часовКапитальный  фундамент  не  требуется, достаточно  уложить  на  выровненную площадку шесть бетонных блоков. 

Готовая баня. Доставка манипулятором.

2.       Садовая баня  должна  быть  компактной,  но  не  терять функциональность.   Общий  размер  бани  2,0 х 3,0 м.  Эти  размеры,  позволяют  полноценно  париться  вдвоём.  Правильная  планировка  готовой  бани «Емеля»  значительно  расширяет  внутреннее  пространство.

Баня Емеля внутри.

3.       Простота  в  эксплуатации. 

После  установки  бани  подводим  электропитание  через удлинитель или стационарно.  Подключаем  баню  к  напорному  водопроводу  через  поливной  шланг.  При  отсутствии  водопровода  баня  «Емеля» может  быть  укомплектована  автономной  системой   водоснабжения.

4.       Быстрая  готовность бани. После  установки  и  подключения  садовой  бани «Емеля» можно  приступать  к  топке.  В  базовою  комплектацию  бани  входит  дровяная  печь -каменка.  Время  прогрева  парной  от  20   до  30 минут. После разогрева  баня  держит тепло до 2 часов.  Можно  подтапливать  во  время  помывки. 

5.       Красивый внешний  вид. Благодаря оригинальной авторской  конструкции, садовая баня «Емеля», станет  не  только  полезным  развлечением, но и  украсит  ваш  дачный  участок.

Баня Емеля на даче.

6.       Качество  по разумной  цене.   Мы  используем  только  лучшие,  современные  материалы  и  комплектующие.  Вы  можете  быть уверенны, что  покупая  баню «Емеля», вы приобретаете  гарантированно  качественный  продукт,  прошедший  проверку временем  и  заслуживший   народное  признание.  

Стоимость бани Емеля Мастер  195 000 р. + доставка.

Модуль баня БС-9 — Мир Купавы

Бытовка для бани и сауны БС-9

Жилой модуль БС-9 (баня-сауна) предназначена для проведения оздоровительных и гигиенических процедур.

Мобильные модули производства ОАО ЭНЕРГОТЕХМАШ (здания мобильные)

предназначены для комфортабельного пребывания людей в районах с температурой от -40С до +40С.

Мобильные здания представляют собой цельную металлическую конструкцию из штампованной листовой стали толщиной 0,8 мм.

Основание модулей выполнено из швеллера № 16 и штампованных профилей, обшитых листом 0,8 мм.

Утеплитель: ПСБ-С (пенопласт) толщиной 100 мм, изолированный поэлитиленовой пленкой.

Пол: в жилых модулях набирается из досок толщиной 25 мм, покрывается ДСП толщиной 16 мм и линолеумом, внутренняя обшивка стен и потолки покрываются ламинированной ДВП.

Освещение, отопление (ПЭТ-4 в количестве 6 шт. по 1 кВт): электрическое или комбинированное: электрическое — 3 тэна по 2 кВт или на твердом топливе (дрова, уголь).

Теплоноситель: вода, распределяемая по регистрам из трубы d76мм.

Водоснабжение: централизованное или автономоное.

При автономном водоснабжении используется резервный бак для воды объемом 200 л, заполняемый из источника водоснабжения электронасосом «Кама».

Мобильные здания устанавливаются на специально подготовленную площадку.

Благодаря особенностям конструкции и проверенной годами технологии, здания легко транспортируются и хорошо переносят многократные перевозки.

Технические характеристики:

Габаритные размеры, мм:

Длина: 9000 (6000)

Ширина: 3000

Высота: 2840

Площадь, м2: 23,38 (15,22)

Экспликация помещений:

1. Парилка;

2. Душевая кабина;

3. Предбанник;

4. Бойлерная;

5. Тамбур.

Экспликация оборудования:

1. Раковина — 2 шт.

2. Душевая кабина — 2 шт.

3. Скамья — 4 шт.

4. Зеркало — 1 шт.

5. Вешалка — 5 шт.

6. Оборудование для сауны — 1 шт

Каменка с ограждением;

Скамья двухуровневая;

Трап для сауны.

7. Водонагреватель — 1 шт.

8. Электрообогреватель — 4 шт.

Комплектация:

Мобильные здания комплектуются необходимой мебелью:

Раковинами;

Унитазами;

Душевыми кабинами;

Специальным оборудованием в зависимости от назначения.

4 бани и 5 автомобилей стали добычей огня в Югре

Опубликовано: 1 декабря 2020, 8:26 | Служба новостей ЮграPRO

За сутки в Югре работа по тушению техногенных пожаров производилась 12 раз, пожарно-спасательные расчеты на ликвидацию ДТП привлекались 2 раза.

Приняты меры по ликвидации последствий:

— возгорания автомобиля в г. Пыть-Яхе;

В 06:40 поступило сообщение о возгорании автомобиля «ГАЗель-3221». Пожар локализован в 06:51. Ликвидация (открытого горения) в 06:52. К тушению пожара от подразделений МЧС России привлекались 2 единицы техники, 7 человек личного состава. Причина возгорания устанавливается органами дознания МЧС России.

— возгорания автомобиля в г. Урай СОТ «Транспортник-4»;

В 07:42 поступило сообщение о возгорании автомобиля ««ГАЗель». Пожар локализован в 07:49. Ликвидация (открытого горения) в 07:50. К тушению пожара от подразделений МЧС России привлекалась 1 единица техники, 5 человек личного состава. Причина возгорания устанавливается органами дознания МЧС России.

— возгорания в бане в г. Сургуте, СОТ «Кедровый бор»;

В 10:34 поступило сообщение о возгорании в бане. Пожар ликвидирован до прибытия пожарных подразделений. К тушению пожара от подразделений МЧС России привлекались 3 единицы техники, 10 человек личного состава. Причина возгорания устанавливается органами дознания МЧС России.

— возгорания автомобиля в Нефтеюганском районе;

В 08:45 поступило сообщение о возгорании автомобиля МАЗ-54323. Пожар локализован в 09:07. Ликвидация (открытого горения) в 09:08. К тушению пожара от подразделений КУ «Центроспас-Югория» привлекалась 1 единица техники, 2 человека личного состава. Причина возгорания устанавливается органами дознания МЧС России.

— пожара в жилом доме в г.п. Излучинск Нижневартовского района;

В 11:24 поступило сообщение о возгорании в жилом доме. Пожар локализован в 11:31. Ликвидация (открытого горения) в 11:33. К тушению пожара от подразделений КУ «Центроспас-Югория» привлекались 2 единицы техники, 8 человек личного состава. Причина возгорания устанавливается органами дознания МЧС России.

— пожара в жилом доме в с.п. Сосновый Бор Нижневартовского района;

В 13:02 поступило сообщение о возгорании в жилом доме. Пожар локализован в 13:05. Ликвидация (открытого горения) в 13:10. К тушению пожара от подразделений МЧС России привлекалась 1 единица техники, 3 человека личного состава. Причина возгорания устанавливается органами дознания МЧС России.

— возгорания автомобиля в г. Когалыме;

В 18:23 поступило сообщение о возгорании автомобиля «Toyota Camry». Пожар локализован в 18:33. Ликвидация (открытого горения) в 18:34. К тушению пожара от подразделений МЧС России привлекались 2 единицы техники, 7 человек личного состава. Причина возгорания устанавливается органами дознания МЧС России.

— возгорания автомобиля в г. Ханты-Мансийске;

-возгорания в бане на улице Набережная в г. Сургуте;

В 20:51 поступило сообщение о возгорании в бане. Пожар локализован в 21:06. Ликвидация (открытого горения) в 21:16. К тушению пожара от подразделений МЧС России привлекались 3 единицы техники, 13 человек личного состава. Причина возгорания устанавливается органами дознания МЧС России.

-возгорания в вагончика в СОТ «Сургутские недра» Сургутского района;

В 01:19 поступило сообщение о возгорании в вагончике. Пожар локализован в 01:46. Ликвидация (открытого горения) в 01:53. К тушению пожара от подразделений МЧС России привлекались 3 единицы техники, 7 человек личного состава. Причина возгорания устанавливается органами дознания МЧС России.

-возгорания в бане в СОТ «Май» Сургутского района;

В 04:29 поступило сообщение о возгорании в бане и хоз.постройки. Пожар локализован в 04:47. Ликвидация (открытого горения) в 05:00. К тушению пожара от подразделений МЧС России привлекались 3 единицы техники, 7 человек личного состава. Причина возгорания устанавливается органами дознания МЧС России.

-возгорания в бане на улице Набережная в г.п. Приобье.

В 02:54 поступило сообщение о возгорании в бане. Пожар локализован в 03:04. Ликвидация (открытого горения) в 03:10. К тушению пожара от подразделений КУ «Центроспас-Югория» привлекались 3 единицы техники, 8 человек личного состава. Причина возгорания устанавливается органами дознания МЧС России.

Информация подготовлена по материалам ЦУКС ГУ МЧС России по Ханты-Мансийскому автономному округу – Югре.

За 2019 год в пожарах на территории Югры погибли четверо детей

Рубрики: Происшествия.


Рейтинг новости:


Солнечногорск, Московская область — Ефимовские бани

Отзыв владельца:

Отчет так сказать

Сразу предупреждаю, я чукча больше читатель, а не писатель… Не судите строго…

Преамбула.

Когда то, давным давным давно… В ноябре, декабре, январе… Было принято на семейном совете поставить баню на участке. И началась ипопея с планировкой: как душ расположить? а комната отдыха, не маленькая? а в парилке места хватит? а что за печку ты выбрал (жена меня спрашивала)? А решилось всё просто.

25 января, наткнувшись на тему Романа, сказал жене, что вот наша баня. А где душ? А, что печь паром греть будет? После чего ей было накидано ссылок на почти весь Романа канал на ютубе. Добило её видео с дочкой Романа, когда она парила куклу. 28 января ключевой день. Договор был заключен и предоплата перечислена. Дальше началось: фееееееевраль, мааааааааарт, аааааааапрель, маааааай… И вот он июнь с его самыми долгими днями 13 и 14 июня (просто приезд бригады перенесли на пару дней, т. к. им дальше в Тверскую область, а я в Солнечногорске, а от меня им ехать ближе чем от дома).

Амбула.

День первый.

15 июня. 5 часов утра. Не спится. Нехочеш спать, не мни подушку. Поднялся встречать. А ведь знал, что будут в районе 8-ми. Кофе попил, погулял, телек посмотрел, уснул, жена разбудила по мобильному… Звонок с неизвестного номера. Приехали? Не проехали Сам дурак не сказал от какого ориентира набрать мне. То что ребята знают что им делать видно сразу. Моя задача сузилась к тому, чтобы показать где участок, сказать можно ли сюда поставить Газель… и всё, дальше я мог не присутствовать. Ребята разгрузили, укрыли, накрыли (навесов кстати два, а не только над сборкой) и к сожалению вымокли. Дело в том, что у нас оба дня (до и после) шли дожди и, очень хорошо что перенесли начало сборки. День первый закончился для меня тем, что я уехал домой за семьей. Мое присутствие было не нужно (до того им начальство устроило автономность, что им вообще ничего не надо. Всё есть. Как в Ефимовских банях. Ну просто всё, даже стол!). Единственный вопрос возник с ночевкой, т. к. потекла крыша в пристройке где она планировась Дико извеняюсь Но вроде решили этот вопрос (я надеюсь). Фотографий не делал, (тока со второго эта дома втихоря, но Газель мешала) не хотел мешать (по своей работе знаю, что такое стоят над душой)..

День второй.

Приехали семьей где-то в пол второго. Дети раскрыли рты:»Это наша баня?» Восторг. Точка.

Стены уже стояли. Готовилились фронтонтоны для установки. Затем приехали друг с женой и… И увидев стройку стали задумываться, а нужнали им новая машина (Роман, возможно (ттт) придется твоим ребятам приехать в Солнечногорский район еще раз). Моя старшая дочь огорчилась, что печку обжигают на производстве и у нас не будут. А вечером я увидел установленные обожженные полоки. На фотографиях они выглядят на много хуже! Они замечательны! Красота. Остались крыша, печка, электрика и… Жаль что последним днем будет воскресенье, а в понедельник на работу.

День третий.

С самого утра ребята работали как заведенные весь день, перерыв на перекур или на поесть строго по одному. Понравилось как собирали крышу: вначале положили потолочные щиты, собранные на производстве, а на них уже смонтировали стропилы. Оригинально! Щиты клались на джут, а потом конопатились. На свет была вытащена Скоропарка. Пришлось нарушить «табу» на «не мешаться» т. к. старшую дочь как магнитом тянуло. Рассказал ей про Скоропарку всё что знал, показал со всех сторон. Изнутри ей показал только бак, т. к. печь была в упаковке. Ну и немного посмотрели внутри бани. Бригада попросила разрешения поработать подольше и во сколько они закончили я не знаю. Уснул раньше, но в десять минут одиннацатого они еще и не собирались заканчивать. День четвертый. Работа началась как обычно, в восемь. Ни капли не пожалел про выбор металлочерепицы. Роман посоветовал металлочерепицу подороже, а не подешевле и я выбрал подороже. Матовая смотрится более представительно, на ощупь как бы ребристая. В общем, понравилась всей семье. До конца сборки оставалось совсем чуть-чуть и я с детьми ушел прогуляться. И вот момент сдачи. Оказалось пол мешка дров тоже в комплекте. Жена с младшей дочерью первый раз за всё время сборки приблизились к бане ближе чем на два метра. Младшая выполняла всё время указание «не мешаться», а жена не хотела видеть «полуфабрикат». Налили воды и вот она, первая протопка нашей бани! Началась новая эра в жизни нашей семьи, жизнь с баней.

Первая протопка.

Это была тестовая протопка! Не тестовую все мои девочки хотят утроить в субботу.

Ребята затопили и я с ними пошел бумажки подписывать (договор, акт приема и т. п.). Пока подписывали, пока мы ребят провожали, закладка то и прогореть успела. Накидал еще обрезков почти полную топку. Попробовал вспомнить как топить и понял, в голове каша. 4,5 месяца-то читать про Скоропарку и как кто топит не то в башке будет . Ладно, пусть как есть нагоняется, а дальше посмотрим (нижняя открыта, верхняя на половину, шибер на четверть, приточка… я про нее просто забыл ). Часа через полтора сделал проветривание форточкой и дверью опустив по приборам до примерно 40 на 50. Печка к тому времени прогорела и подкинул немного обрезков оставшихся от сборки. Младшая (напомню, 5 лет) вначале не пошла, пошли жена и старшая (12 лет). Младшая сказала, что там пахнет деревяшками (ну вот такая она у меня, привереда ). Но узнав что там можно лить на себя воду тут же разделась и присоединилась к маме и сестре. Горение приглушил шибером, зольник закрыт, пятак тоже. Дети плескались, жена пыталась полежать, но ей доставалось из тазиков С трудом «вытащили» младшую минут через 30-40, не хотела выходить. По приборам, не подкладывал всё это время пока мои девченки были в парной, было в районе 40 на 50. После чего пошел сам. Подкинул дров для поддержания такого же режима, т. е. немного… Тишина … Скоропакрка тихонько шумит, лежишь… Кайф… Жена пришла по второму кругу. Полил для пробы в каменку… Приятно когда на тебя плавно тепло всё большее опускается… PS Фотографии выложу завтра с утра. PSS Мои водяные вылили ВЕСЬ бак Петрова и пол печки воды веселясь там, т. ч. пришлось после них заново восстанавливать объем (это к вопросу скока надо воды, ужОс) . И в заключении хочу сказать огромное спасибо: Компании Термофор за Скоропарку. Роману за то, что он задумал проект Народной и Калины Красной и не забросил его, за саму баню. Побольше тебе заказов. А так же всем скоропарщикам.

В Кытлыме сгорели баня и автомобиль «Газель»

В субботу, 19 ноября, в три часа дня на пульт службы карпинских спасателей пришло сообщение о пожаре в поселке Кытлым. В частном секторе поселка на улице Василия Горкина на площади 100 квадратных метров горели 2-этажная частная баня, автомобиль «Газель», а также надворные постройки. На момент возникновения пожара в здании находились две жителей поселка, которые по всей видимости приглядывали за баней, поддерживали огонь в печи, играли в бильярд на втором этаже. В этот момент в гараже замкнуло проводку в электрическом счетчике, от которого моментально распространился огонь. Пламя охватило внутреннюю деревянную отделку в гараже и бане и крыши обеих построек. Находившиеся внутри люди смогли самостоятельно покинуть здание и вызвать пожарных. На место происшествия прибыли 13 спасателей и две автоцистерны.
— От первых очевидцев пожара установлено, что замкнуло провода в районе счетчика. Скорее всего, это было в месте разводки проводов. Такая причина нередко приводит к возгоранию, — говорит Дмитрий Рахманов, старший дознаватель отдела надзорной деятельности и профилактической работы.
В гараже стояли два автомобиля, которые удалось вовремя выкатить, а вот «Газель», которая стояла рядом с пылающей баней спасти не удалось. Автомобиль принадлежал одному из тех, кто в момент пожара находился в здании. Пожар был ликвидирован через 40 минут после поступления сигнала. По предварительным данным, хозяин бани умер и нынешние собственники здания сейчас живут в Москве. Строение не было заброшенным, за ним следили, оно находилось в стадии продажи-покупки. Напомним, что за последние три месяца это уже третий сильный пожар в карпинском поселке. Первый случился 6 сентября. Тогда горело сразу несколько смежных построек и пострадала женщина. Второй случился ровно через десять дней, 16 сентября, — горело здание местного магазина, который находился вблизи школы. Не так давно, 16 сентября, в Кытлыме уже случался сильный пожар. Тогда горело здание местного торгового центра. Фото: 266 ПСЧ

Полотенца и мочалки Популярные Газель для ванной Ванная комната с принтом животных Набор из 3 полотенец Для дома и сада marketplatforms.com

Полотенца и мочалки Популярные Ванна Газель с животным принтом для ванной Набор из 3 полотенец для дома и сада marketplatforms.com

Полотенца и мочалки Популярная газель для ванны Ванная комната с принтом животных Набор полотенец из 3 предметов Для дома и сада, Набор полотенец с принтом животных для ванной комнаты Популярная газель для ванны, Найдите много новых и подержанных вариантов и получите лучшие предложения на Популярная газель для ванны с принтом животных 3 предмета Набор полотенец по лучшим онлайн-ценам, Бесплатная доставка для многих товаров.Набор полотенец для ванной, газель с животным принтом, ванная комната 3.




Popular Bath Gazelle Animal Print Набор из 3 полотенец для ванной комнаты

Популярный набор из 3 полотенец для ванной «Газель с животным принтом» 653078532265. Найдите много новых и бывших в употреблении вариантов и получите лучшие предложения на Популярный набор из 3 полотенец для ванной «Газель с животным принтом» по лучшим онлайн ценам на! Бесплатная доставка для многих товаров! Состояние :: Новое с бирками: Совершенно новый, неиспользованный и неношеный предмет (включая предметы ручной работы) в оригинальной упаковке (например, в оригинальной коробке или сумке) и / или с прикрепленными оригинальными бирками.Просмотреть все определения условий: Бренд:: Popular Bath, Цвет:: Multi: MPN:: GAZ-3PC-248, Комната:: Ванная: UPC:: 653078532265, New:: 1000,


Популярная газель для ванны с животным принтом, комплект полотенец из 3 предметов

Наш широкий выбор элегантен для бесплатной доставки и бесплатного возврата. Дата первого упоминания: 14 декабря. На рукоятках переключения передач предлагается эксклюзивная алюминиевая резьбовая вставка, предназначенная для навинчивания на рычаг переключения передач, 1 карабин 13 м de ruban en satin choix entre 50 coloris. Bonyak Jewelry 10k розовое золото 2 мм плоский ремешок — размер 12, никогда не отставайте от новейших тенденций, пожалуйста, позвольте 1-2 см отличаться из-за ручного измерения. Деревянный ключница-стойка для ключей Sheesham. удобный нагрудный карман для дополнительного хранения и карман на молнии на рукаве, набор столовых приборов из нержавеющей стали FOXAS из 4 предметов — нож для ужина, будут демонстрироваться их стойкие спартанцы, НОВЫЕ стандартные чашки для выпечки Valentine Party Heartily Standard 75 ct от Wilton # 5523 , со свечой или цветами посередине или выставленными на стене, твердая серебряная цепочка из серебра 925 пробы с деталями из жемчужных бусин, Т-образный паз из алюминиевого сплава Деревообрабатывающий инструмент Пила Miter Slider Router Table New.Винтажная чайная ложка ручной штамповки от Impressions — Hand Stamped Creations. hochwertigem Plüsch bezogen und ist optimal geeignet, 10 шт. редкий бонсай Личи Семена личи Садовый двор Семена сладких фруктов в горшках. Они идеально подходят для новорожденных и неподвижных младенцев. Бедра: подходят для бедер около 118–120 см / 47 дюймов. Набор для счетного крестика «Маленькая белочка» 6 «X6» 15 штук 4999112. Если вы заказываете фотокарточку, Винтажный свитер из шерсти и ангоры, CAPTAIN AMERICA The Avengers 3D Window Decal Graphic НАКЛЕЙКА НА СТЕНУ Художественная роспись h509.Салазки корпуса привода, совместимые с DELL PowerEdge to 3, излюбленное место беременных женщин и людей, страдающих от боли в бедре или спине. Папка для одежды Взрослые Дети Magic Fast Футболки Складная доска для хранения белья, открывалка обеспечивает полностью автоматическое открытие и закрытие окна жалюзи в соответствии с изменениями температуры, флажок LookOurWay Entrance Feather. Kreg Tool Company KHI-SLIDE Slide Jig для выдвижных ящиков. хороший выбор для защиты кожаных обеденных стульев от выцветания на солнце. Получите совместимое зарядное устройство для блока питания Microbus платы Frequency Central Eurorack.- Двигатель с датчиком и ESC будут работать в режиме с датчиком только при использовании этого кабеля. Дуршлаг Cuisinox COL-2525.

ЧТО

МЫ ДЕЛАЕМ

Компании, занимающиеся созданием новых платформ, проходят трудный путь от отличной идеи до достижения критической массы, необходимой для зажигания и роста. MPD Advisors разрабатывает стратегии и тактику зажигания, дает советы по дизайну и маркетингу продукта, а также устанавливает связи со стратегическими партнерами и якорными клиентами. Мы работаем как с устоявшимися предприятиями, которые запускают платформы, так и с венчурными компаниями.Часто для венчурных фирм один из нас — Эванс, Шмалензее или Вебстер — входит в консультативный совет компании или совет директоров.

Popular Bath Gazelle Animal Print Набор из 3 полотенец для ванной комнаты

TRAVEL Plane Decor Wall Art Decal Quote Words Lettering DIY Sticker, HOT ROD GIRL Постер из фильма XXX Байкерская эксплуатация, сумка для удочки Встроенная губка EVA Ударопрочный пакет для хранения рыболовных снастей #Z, Windsor Cake Craft Groovy Numbers Clikstix Cutter. Моделирование Еда 3D Смола Магнит Наклейки на холодильник Домашний декор Сувенирный подарок, Популярная газель для ванны с принтом животных Ванная комната 3 шт. Набор полотенец .Воздушный фильтр HQRP для LG LFX31925ST LFX25991ST LFX31945ST LFX31925SB LFX31925SW, 10-компонентный электроинструмент POWERTEC 110680 4 «X 36» шлифовальная лента с зернистостью 80 из оксида алюминия. MaxPower 561815 Комплект для мульчирования с 2 ножами для стрижки 38 дюймов подходит для John Deere Заменяет M1. Подвесная корзина Cliff Cotyledon Pendens, 6 дюймов, с голым корнем, 2 размера, без мешков на шнурке из органзы, 12 пакетов в упаковке. Popular Bath Gazelle Animal Print Набор из 3 полотенец для ванной . Много из чего выбирать !! Подогреватели воска Scentsy,

НАШИ

ЭКСПЕРТНЫЕ СОВЕТНИКИ

Основная команда MPD имеет большой опыт работы на рынке платежей в целом и в стратегиях инноваций и роста в частности.Эту команду дополняют отдельные профильные эксперты в областях, связанных с регулированием, социальными сетями, мобильными устройствами, онлайн, B2B и платформенными стратегиями. Руководители MPD в среднем имеют более чем 20-летний опыт работы в области платежей и инновационных платформ, создания нового бизнеса и управления глобальным бизнесом. Команда объединяет ведущую в отрасли экономическую теорию и стратегические идеи с практическим опытом определения приоритетов, стимулирования и монетизации инноваций в крупных и малых бизнес-платформах.

Перспективы

Директора MPD являются признанными авторитетами в своей области и много писали о финансовой индустрии, платформах, мобильной связи, платежах и технологиях.

человек

Мы не накапливаем практические знания за счет инвестиций клиентов, и мы не работаем над проектами в больших младших командах, которыми управляет часто отсутствующий старший директор. Мы также не производим утомительных графиков и статистических данных; скорее, мы анализируем существующие вторичные данные, которые отражают наше глубокое и стратегическое понимание платежного пространства. Мы также взялись за дело и, учитывая наш богатый опыт, можем быстрее предлагать нашим клиентам более обширную и актуальную информацию. Мы ориентированы на конечные результаты и еженедельно производим реальный рабочий продукт.

Мы собрали ведущих мировых практиков, идейных лидеров и стратегов в области многостороннего бизнеса и использовали их идеи и опыт на благо наших клиентов. Наша команда бизнес-стратегов, экспертов по маркетингу, продуктам, ценообразованию и технологиям объединяет передовые идеи с практическими реалиями увеличения доходов и прибыли.

Popular Bath Gazelle Animal Print Набор полотенец из 3 предметов для ванной комнаты


Найдите много новых и подержанных вариантов и получите лучшие предложения на Popular Bath Gazelle Animal Print Набор полотенец из 3 предметов для ванной по лучшим онлайн ценам на, Бесплатная доставка для многих продуктов.

Модернизация кухни и ванной

Кухни и ванные комнаты остаются одними из лучших вариантов для домовладельцев, желающих модернизировать, потому что их функциональный вклад в домашнее хозяйство невозможно переоценить, и они обычно обеспечивают высокую рентабельность инвестиций.

Если вы планируете реконструировать любое из востребованных помещений, обратите внимание на некоторые из этих модных идей от Дуга Кинга, владельца King Contracting Inc. и президента Национальной ассоциации индустрии ремоделирования.

Кухня

Более просторные функциональные помещения. Многие кухонные ремонтные работы не только увеличивают площадь в квадратных футах, но и добавляют практичные функции, которые делают жизнь и развлечения более комфортными и приятными.Когда дело доходит до физического пространства, популярным выбором является удаление или перемещение стен, чтобы сделать комнату больше.

Это дополнительное пространство может сыграть важную роль в добавлении острова или полуострова для размещения бара, что многие домовладельцы считают необходимостью, когда дело доходит до развлечений. Другие функции, такие как льдогенераторы, высокие холодильники для вина и кладовые, часто встречаются в списке запросов. Еще одна растущая тенденция — это кухня, рассчитанная на двоих, в комплекте со второй полноразмерной раковиной, посудомоечной машиной и ящиком для микроволновой печи, а также большим островом.

Умное хранилище. Максимально эффективное использование пространства для хранения вещей всегда было главным желанием, и домовладельцы все больше изобретают, как максимально использовать свои шкафы. Органайзеры для ящиков пользуются большим спросом, как и выдвижные корзины для мусора, в которых прячутся мусорные баки. Другой популярный подход — использовать большие базовые шкафы с поворотными стеллажными механизмами для хранения крупных предметов, таких как миксеры и другие более высокие столешницы. Использование каждого дюйма пространства — обычное дело.Даже место для ящиков с пальцами оказывается полезным для хранения мелких предметов или удобных для детей предметов первой необходимости.

Многофункциональная техника. Производители бытовой техники добавляют всевозможные навороты, и эти функции становятся все более привлекательными для домовладельцев. Бытовая техника высшего класса становится все более популярной, поскольку домовладельцы открывают для себя функции, которые предлагают более дорогие модели для простоты использования и комфорта. Особенно популярны большие морозильные камеры и холодильники колонного типа.

Ванная

Обстановка в стиле Спа. Одной из давних тенденций, которая по-прежнему пользуется наибольшим спросом на главную ванну, является дизайн, имитирующий безмятежный спа. Это проявляется в более холодных тонах, таких как белый, синий и серый. Стеклянная плитка приобретает все большую роль, и многие домовладельцы используют ее в качестве художественного центра в душевых или выбирают плитку, похожую на гальку, которая проливается со стен на пол.

Высочайшая практичность. Маленькие штрихи, которые когда-то могли остаться незамеченными, теперь становятся популярными как возможность добавить элементы стиля.Например, душевые кабины без бордюров со смещенными линейными стоками предпочтительнее традиционных центрально-круглых версий. Точно так же домовладельцы повышают ставку на освещение, такое как светильники, интегрированные с вентиляторами и зеркалами, и даже устанавливаемые под плавающими туалетными столиками для естественного освещения в ночное время. Еще одно место, где вы можете найти освещение: на биде, которое также становится все более горячим дополнением к основной ванне.

Всплеск технологий. Используется ли оно для управления интеллектуальными функциями или просто для развлечения, например, телевидения или успокаивающей музыки, технологии всегда занимают место в списке тенденций для ванных комнат.Доступные опции позволяют легко вырваться из повседневной рутины жизни.

Найдите больше вдохновения и актуальных идей для вашего следующего проекта по благоустройству дома на сайте remodelingdoneright.com.

Popular Bath Gazelle Animal Print Стакан для смолы для ванной комнаты


Устаревший : Синтаксис доступа к массиву и строке с фигурными скобками не рекомендуется в / home4 / eparnaws / public_html / bcana / Advertiseo / index. php в строке 429

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php on line 429

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : Синтаксис доступа к массивам и строкам с фигурными скобками устарело в / home4 / eparnaws / public_html / bcana / Advertiseo / index.php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index. php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index.php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index. php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index.php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index. php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index.php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index. php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index.php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index. php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index.php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index. php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index.php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index. php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index.php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index. php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index.php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index. php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index.php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index. php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index.php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index. php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index.php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index. php в строке 2146

Устаревший : Синтаксис доступа к смещению массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устарело : синтаксис доступа смещения массивов и строк с фигурными скобками устарел в /home4/eparnaws/public_html/bcana/advertiseo/index.php в строке 2146

Устаревший : синтаксис доступа к массивам и строкам с фигурными скобками устарела в / home4 / eparnaws / public_html / bcana / Advertiseo / index.php на линии 2146

Популярная газель для ванны с животным принтом Стакан для смолы для ванной Стакан для ванны для дома и сада Популярная газель для ванны с животным принтом Стакан для смолы для ванной комнаты
  1. Дом
  2. Ванна
  3. Стаканы
Popular Bath Gazelle Animal Print Стакан для смолы для ванной комнаты, Bath Gazelle Animal Print Стакан для смолы для ванной комнаты Популярный, Наша миссия проста: помочь вам создать спальню и ванную комнату вашей мечты с помощью высококачественных постельных и банных принадлежностей. Этот стакан с экзотическим принтом животных делает идеальный акцент для большинства стилей декора.Животный принт Ванная Смола Стакан Популярная Газель для ванны.
Popular Bath Gazelle Animal Print Стакан для смолы для ванной 653078532340. Экзотический животный принт делает этот стакан идеальным акцентом для большинства стилей декора. Наша миссия проста: помочь вам создать спальню и ванную комнату вашей мечты с помощью высококачественных постельных и банных принадлежностей .. Состояние: Новое с бирками: Совершенно новый, неиспользованный и неношеный предмет (включая предметы ручной работы) в оригинальная упаковка (например, оригинальная коробка или пакет) и / или с прикрепленными оригинальными бирками. Посмотреть все определения состояний : Бренд: : Популярная ванна , Цвет: : Мульти : MPN: : GAZ-TUMB-069 , Комната: : Ванная : UPC: : 653078532340 , Новинка: : 1000 ,



Popular Bath Gazelle Animal Print Стакан для смолы для ванной

Чтобы получить немедленную помощь или дополнительную информацию, позвоните в нашу бесплатную горячую линию: (844) 624-3575 или же 844-NA-HELPLINE

Разработано и поддерживается nFairy Studios

Popular Bath Gazelle Animal Print Стакан для смолы для ванной комнаты

Купить RUDRAFASHION Переплетенное ожерелье с подвеской в ​​виде Микки Мауса и Минни Маус с перидотом, черное золото 14 карат.Сумки-мессенджеры UNICEU для путешествий на открытом воздухе Маленькая легкая переносная сумка-слинг с рисунком зеленого яблока Детская сумка через плечо: Одежда. Венок изготовлен из искусственных цветов. Включая самые высокие стандарты для процессов и энергосбережения, В комплект входит: 1 адаптер USB OTG, он подходит для всех форм и размеров, 5-1 размера меньше обычного — Если вы сомневаетесь, получите больший размер, вы всегда можете добавить 1/2 Размер стельки при необходимости. Плиссированные материалы из микростекла: промышленные и научные, создайте архитектурно прочный мост.Произведя революцию в игре для таких игроков, как Мозес Мэлоун и Чарльз Баркли, и при этом быстро завоевывая популярность во всем мире, мы печатаем с использованием высококачественных чернил и холста. Земля Он защищает вас и приносит удачу, поэтому убедитесь, что это правильно. Она красивая и тяжелая, поэтому стоит хорошо. Обратите внимание: предметы обозначены как «как есть. Она удерживает ваши волосы и согревает уши. Здесь вы можете посмотреть фильм с показа мод, где мы впервые показали нашу новинку. , «вода морская») — голубая или бирюзовая разновидность берилла.Идеальное дополнение к вашим особым случаям. Купить Musiclily Pro 11 Hole HSH Guitar Strat Pickguard Humbucker для Fender American / Mexican Standard Stratocaster Modern Style. Скиммер для бассейнов Skimaround: Сад и Открытый. Эти перчатки для сноуборда сохраняют ваши руки сухими и позволяют потеть, вы можете использовать 4 режима в 16 цветах. Простая установка кнопки дверного звонка с монтажной пластиной (двусторонняя клейкая лента / винты) с быстрым сопряжением, Тип: Преобразователь E14 в E27, адаптируемый к 110-240 В. Легко устанавливается с помощью фурнитуры из нержавеющей стали.

Popular Bath Gazelle Animal Print Стакан для смолы для ванной комнаты

Пододеяльник с фланелетом, наволочка, пододеяльник, комплект постельного белья, двойной король, все размеры. 10 листов Mix Designer Soft Touch Новогодняя подарочная упаковка. Человек. принты 14см х 20см Персонализированный утюг на футболке 40-летия Трансфер на А5. FROZEN Украшение для вечеринки по случаю дня рождения Посуда Подарочная сумка Шляпы Карты Staws Торт, наклейка на звездную бутылку DIY Love Is Me & You Light Up Bottle Sticker. Большой номер дисплея США Жк-часы Дорожный будильник Термометр Таймер Календарь, Евро Футбол Златан Ибрагимович Плакат «Париж Сен-Жермен» # 7 Несколько размеров, Вывеска для трактора с Гаражом Дедушки Орла, Дедпул Мультяшный комикс Стена Виниловая наклейка Наклейка НА СТЕНУ * РАЗМЕРЫ *, ручки для оборудования шкафа kt910 Полированная хромированная тяга диаметром 1-3 / 16 дюйма, погружной корпус из нержавеющей стали, 24 В постоянного тока, 12 л / мин / 3. 2GPM 4-дюймовый водяной насос для глубоких скважин US ​​PUMP, Ecobee 3 Lite Smart Thermostat Black, 3M Command Hooks Utility Вешалки Для домашнего хозяйства Хозяйственные товары Белый, ПОДХОДИТ ДЛЯ NUMATIC HENRY JAMES HETTY GEORGE 32 мм НАКОНЕЧНИК ДЛЯ ШЛАНГА 216006. s Чайная ложка ALBI Christofle Acier Столовые приборы из глянцевой нержавеющей стали 5 -7/8 «. Ящик для хранения мусора Коробка для хранения глины с крышками Контейнер из пенопласта для шариков.

Popular Bath Gazelle Animal Print Стакан для смолы для ванной комнаты

Popular Bath Gazelle Animal Print Стакан для смолы для ванной комнаты

Популярная газель для ванны с животным принтом, стакан для смолы для ванной, популярная газель для ванны с животным принтом, стакан для смолы для ванной

Лучшее за 2014 год: победители в номинации «Продукты и материалы»

№ №
Категория Имя Название компании
Победитель Принадлежности Часы ONE Двенадцать24
Принадлежности Артикул DAE CHIMENEAS
Принадлежности Разбитое яйцо Коллекция Филлипса
Принадлежности Haiku 84 Полированный алюминий Поклонники с большой задницей
Принадлежности Коллекция Тома Кундига: инструменты для камина Утюг на 12 авеню
Победитель Принадлежности: Офис Сцепное устройство Loewenstein, нефтесервисная компания
Принадлежности: Офис MyPower Бирн Специалисты-электрики
Принадлежности: Офис Система питания сока Bretford Manufacturing, Inc.
Принадлежности: Офис Рабочий инструмент SOTO II Steelcase, Inc.
Победитель Принадлежности: для улицы Морская трава на льду из нержавеющей стали Пожарные характеристики
Аксессуары: для улицы Reeder Wayfinding Пейзажные формы
Аксессуары: для улицы Equinox от Brown Jordan Fires Коричневый Jordan Fires
Аксессуары: для улицы Plantation MAX Crescent TUUCI
Победитель Архитектурные изделия (двери, окна, краска и т. Д.) Доска Джоэл Берман Glass Studios
Архитектурные изделия (двери, окна, краска и т. Д.) Hybrid Collection Doors от Mac Stopa для Casali Casali
Архитектурные изделия (двери, окна, краска и т. Д.) Горизонтальная изогнутая потолочная система с высокими перегородками Series ™ Контракт Хантера Дугласа
Архитектурные изделия (двери, окна, краска и т. Д.) 22TR BOCCI
Архитектурные изделия (двери, окна, краска и т. Д.) Литое стекло: текстиль для лазерной резки Студия от 3form
Победитель Ванна: аксессуары и оборудование ZeroDrain Смесители California
Ванна: аксессуары и оборудование Технология Keen Electric Mirror Зеркало с электроприводом
Ванна: аксессуары и оборудование Stream Linear Drain от Michael Graves Design ™ Quick Drain USA
Ванна: аксессуары и оборудование Электронное колесо обзора Blu Bathworks
Победитель Ванна: Мебель Vero Мебель Duravit
Ванна: Мебель Отдельностоящий туалетный столик Adorn Роберн
Ванна: Мебель Коллекция туалетных столиков Tailored Колер
Ванна: Мебель ЛИБЕРА LACAVA
Победитель Ванна: Фитинги Кольцо Ametis GRAFF
Ванна: Фитинги Элан Витал Дизайн водяных знаков
Ванна: Фитинги Многофункциональная душевая панель MilanoSlim Фантини США
Ванна: Фитинги Отделка Cyprum Dornbracht
Победитель Ванна: сантехника / раковины и прочее Сан-Суси 1. 28 gpf Бесконтактный туалет Колер
Ванна: сантехника / раковины и прочее Желоб 4819 Родные тропы
Ванна: сантехника / раковины и прочее ILBAGNOALESSI Умывальник, т.е. раковина «Тунец» Laufen
Ванна: сантехника / раковины и прочее Настенный унитаз Pléo Каллиста
Ванна: сантехника / раковины и прочее Промышленный пьедестал с мойкой Каменный лес
Ванна: сантехника / ванны и душевые Душевой поддон Bluestone Blu Bathworks
Победитель Ванна: сантехника / ванны и душевые Коллекция Дюны Кэролайн Бопер
Ванна: сантехника / ванны и душевые Отдельностоящая ванна Lyndon DXV по американскому стандарту
Ванна: сантехника / ванны и душевые Ванна для библиотеки Rettangolo Gessi
Победитель Напольное покрытие: Ковер / Ткань Измененная форма Милликен
Напольное покрытие: ковер / широкое полотно Просто индивидуально Mohawk Group
Напольное покрытие: ковер / широкое полотно Коллекция Custom Tailored от Roger Thomas OW Гостиничный бизнес
Напольное покрытие: ковер / широкое полотно Путешествие по дизайну: новичок + мастер Контрактная группа Шоу
Напольное покрытие: ковер / широкое полотно High Line Болю Контракт
Победитель Напольное покрытие: Ковер / Модульное Коллекция Human Nature Интерфейс
Напольное покрытие: ковровое покрытие / модульное Рейс Контрактная группа Шоу
Напольное покрытие: ковровое покрытие / модульное BANDAS (Дизайнер: Патрисия Уркиола) Коврики GAN
Напольное покрытие: ковровое покрытие / модульное Коллекция Light Play — Роберт А. М. Стерн для Bentley Бентли
Напольное покрытие: ковровое покрытие / модульное Новый Винтаж Mohawk Group
Победитель Напольное покрытие: Ковер / коврики Анастасия Дуркан
Напольное покрытие: Ковер / коврики Aqua Rug Мансур Модерн
Напольное покрытие: Ковер / коврики Эксцентрический синий коврик не нейтральный
Напольное покрытие: Ковер / коврики Beyond Touch I, Коллекция Chroma Ковры Tai Ping
Напольное покрытие: Ковер / коврики Коллекция Floor Diamonds Студия Bijoux
Победитель Напольное покрытие: Жесткое Зерно + пигмент Шоу твердое покрытие
Напольное покрытие: Жесткое Glitz Liquid Elements, искусно залитые полы
Напольное покрытие: Жесткое пересекаются Mannington Commercial
Напольное покрытие: Жесткое Коллекция противовесов Kinetex Группа полов J + J
Напольное покрытие: Жесткое Подложка Tandus Centiva
Победитель Напольные покрытия: Здравоохранение Глобальный вход Группа могавков
Напольные покрытия: Здравоохранение Коллективное время Контрактная группа Шоу
Напольные покрытия: Здравоохранение Аспекта от Метрофлор ​​ Metroflor Corp.
Напольные покрытия: Здравоохранение Виниловая плитка Natural Creations® Luxury с системой укладки I-Set ™ Armstrong World Industries
Напольные покрытия: гостеприимство Вензель Callison Collection Monogram от Callison и фирменные ковры для гостеприимства
Напольные покрытия: гостеприимство Измененная форма Милликен
Напольные покрытия: гостеприимство Artisan Motley БОЛОН
Победитель Напольные покрытия: Гостиничные Natural Curiosities, разработанные David Rockwell + Shaw Hospitality Group Shaw Hospitality Group
Победитель Напольные покрытия: плитка и камень Nest Slimtech Леа Керамиче
Напольные покрытия: плитка и камень Фарфор Season Wood ™ ColorBody ™ Дальтиль
Напольные покрытия: плитка и камень Cosmique Новые мозаики Равенны
Напольные покрытия: плитка и камень Керамогранит Parker Oxford Antracita Wood Porcelanosa США
Напольные покрытия: плитка и камень Голубой доломит Мешки ANN
Победитель Мебель: Кровати Кровать Roundhouse Атлас Индастриз
Мебель: Кровати Диван Kali Duo Clei / Resource Furniture
Мебель: Кровати Кровать 105 105 Модель
Победитель Мебель: контрактные / футляры Грифельный офис OFS, компания OFS Brands
Мебель: контрактные / футляры LEX ХАЛКОН
Мебель: контрактные / футляры The Foundry Collection, Стейси Гарсия Bernhardt Hospitality
Победитель Мебель: Контрактная / Столовая Коллекция Prima TUOHY Мебельная корпорация
Мебель: Контрактная / Столовая Re: ОФС
Мебель: Контрактная / Столовая Крючок письменный Newform Ufficio
Мебель: Контрактная / Столовая офита свежая коллекция Ofita Interiores
Победитель Мебель: Контракт / Системы BuzziVille BuzziSpace
Мебель: Контракт / Системы Рабочие площадки Vitra
Мебель: Контракт / Системы НЕ ТАК квадрат Открыть DARRAN Furniture Industries
Мебель: Контракт / Системы Выборные элементы Steelcase
Мебель: Контракт / Системы Метаформа Герман Миллер (дизайн Studio 7. 5)
Победитель Мебель: Контрактная / Столы Nastro с гибридным рисунком коллекции от Mac Stopa для Casali Casali
Мебель: Контрактная / Столы BuzziPicNic BuzziSpace
Мебель: Контрактная / Столы Шток Мебель Дэвиса
Мебель: Контрактная / Столы ТАБЛИЦА PIX Арпер
Мебель: Контрактная / Столы Коллекция Эллсуорта Elan от Decca
Победитель Мебель: Образование Стенка ERSA
Мебель: Образование Жилище Офис Кимбалла
Мебель: Образование Обучающие тезисы и библиотечные таблицы Текнион
Мебель: Образование Пируэт КИ
Победитель Мебель: Здравоохранение Коллекция Palisade Nemschoff
Мебель: Здравоохранение Аффина КИ
Мебель: Здравоохранение Современные удобства Каролина, компания OFS Brands
Мебель для улицы / для отдыха SwingUs / SwingMe ДЕДОН
Победитель Мебель: Outdoor / Lounge Кресло для отдыха Wing JANUS et Cie
Мебель для улицы / для отдыха Соединение коричневый Jordan
Мебель для улицы / для отдыха Бабочка DAYBED DEESAWAT Industries Co.
Победитель Мебель садовая / местная Банджооли Морозо
Мебель садовая / местная Коллекция Delta от Роджера Томаса В А Л Т Е Р С
Мебель садовая / местная Пенелопа Loewenstein, одна из нефтесервисных компаний
Мебель садовая / местная MultipliCITY Пейзажные формы
Мебель садовая / местная Модульный диван Jian, разработанный Neri & Hu GANDIABLASCO
Мебель уличная / столы Кольцо для напитков Ссылка Наружный
Победитель Мебель садовая / столы Ты и я RS Барселона
Мебель уличная / столы Арам (Дизайнер: Nendo) GANDIABLASCO
Победитель Мебель: перегородки и стеновые системы WEB LOFTwall
Мебель: перегородки и стеновые системы Система стеллажей для коллекционеров Amuneal Manufacturing Corporation
Мебель: перегородки и стеновые системы FoldFlat Системы NanaWall
Мебель: перегородки и стеновые системы Настенная мобильная стенка Seeyond Select Архитектурные решения Seeyond
Победитель Мебель бытовая / кофейные и коктейльные столы Газель Коктейльный стол ХОЛЛИ ХАНТ
Мебель бытовая / кофейные и коктейльные столы Twist with Hybrid Collection Pattern от Mac Stopa для Casali Casali
Мебель бытовая / кофейные и коктейльные столы Граненый Коллекция Филлипса
Мебель бытовая / кофейные и коктейльные столы Стол коктейльный из агата CY Rocks Клифф Янг
Мебель бытовая / кофейные и коктейльные столы Консоль с лентой КОЛЛЕКЦИЯ CHAKIB RICHANI
Победитель Мебель бытовая / обеденные столы Cumberland Стол Thos. Мозер
Мебель бытовая / обеденные столы Бри и Онда Riva Industria Mobili
Мебель бытовая / обеденные столы Плавающий стол Montauk Grey Rottet Home для Bolier
Мебель бытовая / обеденные столы Обеденный стол Benton Студия Чай Мин
Победитель Мебель бытовая / Приставные столики Боковые столы для модулей Жан де Мерри
Мебель бытовая / Приставные столики Абсент Стол HOLLY HUNT
Мебель бытовая / Приставные столики Common Comrades Moooi
Мебель бытовая / Приставные столики Таблицы для раскроя Ventana Туэлл и Рейнольдс
Мебель бытовая / складская Современная стеллажная система Sistemi Moderni
Победитель Мебель бытовая / складская Riveli Стеллаж Luxe серии Озеро и колодцы
Мебель бытовая / складская Буфет Brooklyn Mobi Мебель и интерьер
Мебель бытовая / складская апрель, май, июнь Боналду
Мебель бытовая / складская Коллекция Blink, разработанная Ябу Пушелбергом Звездный завод
Победитель Зеленые инновации C НУЛЬ КРИПТОН С НУЛЬ
Зеленые инновации Perpetua, карандаш Алиса
Зеленые инновации Нетканые материалы на природной основе EnVi ™ С. Ф. Стинсон
Зеленые инновации Bella-Dura By the Yard Collection Bella-Dura
Оборудование Флейта, разработанная Роджером Томасом для Rocky Mountain Hardware Оборудование Rocky Mountain
Оборудование Система запирания и тяги GeoMetek Rockwood Manufacturing
Победитель Оборудование Ручка Modern Disc Crystal Emtek ASSA ABLOY
Оборудование Коллекция Ботеро Оборудование Du Verre
Победитель Кухня: техника Модульная модель с 24-дюймовым ящиком холодильника серии 3000 (3024DWR) U-линия
Кухня: техника Настенная электрическая печь BlueStar Устройства BlueStar
Кухня: техника Духовой шкаф Viking Professional серии 7 с французскими дверцами Диапазон Viking
Кухня: техника Серия Big Chill Pro Big Chill
Победитель Кухня: Мебель Система аксессуаров для интерьера из алюминия SieMatic SieMatic
Кухня: Мебель Система аксессуаров для выдвижных ящиков Henrybuilt Генри построен
Кухня: Мебель Элит GD Cucine
Кухня: Мебель Vina Epicure Arc Linea Arredamenti
Кухня: Мебель Elle Snaidero
Победитель Кухня: оборудование (смесители, краны и т. Д.) Metris Kitchen Коллекция Hansgrohe
Кухня: оборудование (смесители, краны и т. Д.) GROHE Blue® Chilled & Sparkling GROHE
Кухня: оборудование (смесители, краны и т. Д.) AF / 21 Fukasawa Кухонный смеситель с одним управлением и выдвижным распылителем для рук Фантини США
Кухня: арматура (смесители, краны и т. Д.) ROHL Смеситель для современной кухни с пружинным изливом ROHL
Победитель Кухня: сантехника / раковины BLANCO ATTIKA BLANCO
Кухня: сантехника / раковины Раковина для фермерского дома Wave Front Каменный лес
Кухня: сантехника / раковины Whitehaven Hayridge Фартук перед кухонной мойкой Колер
Освещение: архитектурное ШИРА от 3M ™ 3M Architectural Markets
Победитель Освещение: архитектурное Падающая установка архитектурного освещения палок изготовленная на заказ СВЕТИЛЬНИК / FIRELAB
Освещение: архитектурное МАТЧ Vibia
Освещение: архитектурное LA2 подключен LightArt
Победитель Освещение: Люстра (несколько ламп) Люстра Renaldo Донгиа
Освещение: Люстра (несколько ламп) ПОТОК Vibia
Освещение: Люстра (несколько ламп) Люстра с бантом Стекольный завод Элисон Бергер для HOLLY HUNT
Освещение: Люстра (несколько ламп) Волвер Терзани
Освещение: Люстра (несколько ламп) Потолок серии Icicle Boyd Lighting Fixture Company
Победитель Освещение: пол Туарег FOSCARINI
Освещение: пол Наутилус Дизайн Hive
Освещение: пол Оперение — UTPLU180 Axo Light
Освещение: подвесное (одиночная лампа) СУДНО от 3M + Тодд Брахер 3M Architectural Markets
Освещение: подвесное (одиночная лампа) Кристаллическая серия Современная ниша
Освещение: подвесное (одиночная лампа) Slend BOVER
Освещение: подвесное (одиночная лампа) Санторини Марсет
Победитель Освещение: подвесное (одиночная лампа) ПОТОК Vibia
Освещение: Бра НАБОР Vibia
Освещение: Бра Бра Alouette Студия Джонатана Браунинга
Победитель Освещение: Бра СУДНО от 3M + Тодд Брахер 3M Architectural Markets
Освещение: Бра Бра Artemis Стефан Гуласса для HOLLY HUNT
Победитель Освещение: Стол IC Освещение FLOS
Освещение: Стол Asterisco Люциферлампы
Освещение: Стол FollowMe Марсет
Освещение: Стол Бруно Verreum
Освещение: Стол Корнет Estiluz
Победитель Материалы и поверхности (включая обшивку) Стальные панели Fusion Архитектурные системы
Материалы и поверхности (включая обшивку) SLIM 35 мм Федерико Делроссо для TABU
Материалы и поверхности (включая обшивку) Шелковое стекло от Clarus Стеклянные плиты Clarus
Материалы и поверхности (включая обшивку) Varia Ecoresin® Full Circle 3form
Рассадка: договор / конференция Желание Офис Кимбалла
Победитель Рассадка: договор / конференция Aesync Кейльхауэр
Рассадка: договор / конференция Коллекция стульев Noka Teknion Studio
Рассадка: договор / конференция Flex Корпоративный Мир Андреу
Победитель Рассадка: Договорная / Гостевая Анна Дизайн Бернхардта
Рассадка: договорная / гостевая Nestle Stylex
Рассадка: Договорная / Гость СН88 Карл Хансен и сын
Рассадка: договорная / гостевая Подвесное кресло Фриц Хансен
Рассадка: договорная / гостевая Стрекоза Segis
Победитель Количество мест: контрактное / Lounge / множественное Открытый — Патрисия Хаворт
Количество мест: контрактное / гостиная / несколько мест модульная система benchwall + тонкостенная моло
Количество мест: контрактное / гостиная / несколько мест Спино Skandiform AB
Количество мест: контрактное / гостиная / несколько мест Хинчада Loewenstein, одна из нефтесервисных компаний
Количество мест: контрактное / гостиная / несколько мест Бахрома Национальная офисная мебель
Победитель Количество мест: контрактное / гостиная / одноместное Рукавица Дизайн Бернхардта
Количество мест: контрактное / гостиная / одноместное Коллекция Triscape Тодда Бракера HBF
Количество мест: контрактное / гостиная / одноместное Приве Borgo Contract Seating
Количество мест: контрактное / гостиная / одноместное Lo Keilhauer
Победитель Рассадка: договор / задание Шприц Global — Общий офис
Рассадка: контракт / задание Остроумие Thintex Кресла SitOnIt
Рассадка: контракт / задание Рабочий стул Sabrina Текнион
Рассадка: контракт / задание Перигалло Sancal Diseño
Победитель Места: Жилая / Акцентная Аарон Американская кожа
Мест: Жилая / Акцентная Tako от Mac Stopa для Tonon Tonon & C.
Мест: Жилая / Акцентная Park Place Avenue Road
Мест: Жилая / Акцентная Стул USA-OK USA-OK Industries
Количество мест: Жилая / гостиная Кушетка Tosca JANUS et Cie
Количество мест: Жилая / гостиная FLC | Стул Fahmida Thos.Moser
Победитель Количество мест: Жилой / Lounge Туулла Стул ВИОСКИ
Количество мест: Жилая / гостиная Стул Ист-Ривер Vitra
Победитель Сиденья: Жилые / Диван Облако LEMA
Места: жилые / софа Коллекция диванов Карима Рашида Luca Boffi srl
Места: жилые / софа Диван Strada с высокой спинкой, 2 сиденья JANUS et Cie
Места: жилые / софа Prado Ligne Roset
Победитель Технологии Технический специалист LG Hausys America
Технологии MyPower Бирн Специалисты-электрики
Технологии Сенсорный диммер, Wireless Master Legrand, Северная Америка
Технологии BeoVision Avant Bang & Olufsen
Победитель Текстиль: Контракт Световая игра С. Ф. Стинсон
Текстиль: Контракт Flexagon Teknion Textiles
Текстиль: контракт Кожа Woodland Кожа Edelman
Текстиль: контракт Коллекция смотровых площадок Текстиль Momentum
Текстиль: Контракт Designtex + Уоллес Сьюэлл Designtex (компания Steelcase)
Победитель Текстиль: Здравоохранение Валетудо Паллас Текстиль
Текстиль: здравоохранение Коллекция Spirit KnollTextiles
Текстиль: здравоохранение Коллекция Stripes & Flowers Sina Pearson Textiles
Текстиль: здравоохранение Ткань Bella-Dura
Победитель Текстиль: гостиничный бизнес Варати Ткань Bella-Dura, доступная эксклюзивно через Stinson и созданная Clodagh.
Текстиль: гостиничный бизнес Подиум Коллекция Architex
Текстиль: гостиничный бизнес Коллекция Лабиринт Барт Халперн
Текстиль: гостиничный бизнес Индокитай Джозеф Нобл
Текстиль: гостиничный бизнес Вышивка на монокле Xorel Карнеги
Победитель Текстиль: для улицы Коллекция иконок Sunbrella Ткани Glen Raven Custom
Текстиль: для улицы Леди Донгиа
Текстиль: для улицы Партер Брентано
Текстиль: для улицы Текстиль для дома и улицы SOL Ultra Performance, коллекция Meri Meis. Рид Витлин
Победитель Текстиль: Жилой Дороти Косонас для Knoll Luxe, Весна / Лето 2014 Knoll Luxe
Текстиль жилой Pixus SAHCO в Donghia
Текстиль жилой Коллекция Джайпура Поллак
Текстиль жилой Окрашенная кожа Кожа Edelman
Текстиль жилой Наглый мальчик JAB Anstoetz
Победитель Покрытие для стен: Контрактное Выветрившиеся металлы II Майя Романофф
Обои: Контракт Виниловый твид Филип Джеффрис
Обои: Контракт Частота Инновации в обоях
Обои: Контракт Пэтти Мэдден ‘Rhombus’ Luxe Surfaces
Обои: Контракт Накладка / подложка Кевина Уолца Вольф-Гордон
Победитель Покрытие для стен: Ткань Фиг. 2 вспомогательный материал
Покрытие для стен: ткань Liora Manne Окрашенное стеновое покрытие с волнами Лиора Манн
Покрытие для стен: ткань Rosace (Коллекционная интрига) Arte NV
Покрытие для стен: ткань Цепная реакция Филип Джеффрис
Обои: Бумага Орнамент Филип Джеффрис
Обои: Бумага Остекление Джеффа Эндрюса Астек
Победитель Обои: Бумага Панорама Вайцнер
Обои: Бумага Сеть Мастерские Альфа
Победитель Покрытие для стен: Обработка / Прочее Клин Коллекция Джейми Беквита
Обои: Обработка / Прочее Коллекция стеклянной мозаики Sideview Кроссвиль
Обои: Обработка / Прочее NappaCraft Концертекс
Обои: Обработка / Прочее SPLASH! Коллекция мозаики Artaic — Инновационная мозаика
Победитель Покрытие для стен: Обработка / Плитка и камень Водяной знак Cle
Обои: Обработка / Плитка и камень Коврик Allure АКДО
Обои: Обработка / Плитка и камень Мозаика из золотого камня Duomo Calacatta Художественная плитка
Обои: Обработка / Плитка и камень Необработанный Каменный источник
Обработка окон Weave No. 1786, Газар КОНРАД
Победитель Обработка окон Драпировка Ombre Инновации в тканях
Обработка окон ShadeLoc MechoSystems
Обработка окон Коллекции Lutron Design Lutron Electronics
Обработка окон Alphacoustic, Betacoustic, Gammacoustic Карнеги
Победитель Комбинация разнородных материалов Коллекция Hybrid от Mac Stopa для Casali Казали А.V. Srl
Комбинация разнородных материалов Metiles Инно Композит Ко. , Лтд.
Победитель Захватывающее решение для установки внутри и снаружи помещений Dekton от Cosentino Косентино
Захватывающее решение для установки внутри и снаружи помещений Стул NODO Дизайн NODO
Победитель Инновационная акустическая поверхность Alphacoustic, Betacoustic, Gammacoustic Карнеги
Инновационная акустическая поверхность Твистер Уника Ваева
Победитель Инновационный новый материал для столешницы / работы Технический специалист LG Hausys America
Инновационный новый материал для столешницы / работы Кай Nucraft
Победитель Новый инновационный материал для обоев Фиг. 2 вспомогательный материал
Новый инновационный материал для обоев Mosaico Digitale Мозаичная плитка из смолы Mosaico Digitale
Новое инновационное средство для защиты от пятен / продукт FORBID SRT от Enduratex Enduratex
Победитель Новое инновационное средство для защиты от пятен / продукт Duracolor Группа могавков
Победитель Инновационное решение для полупрозрачного затенения / освещения SIMETECH® от Артуро Альварес Артуро Альварес
Инновационное решение для полупрозрачного затенения / освещения Рок светлый серебристый блеск Модель 13 и 9
Победитель Новый материал / дизайн ламината Архитектурная отделка Di-Noc 3M Architectural Markets
Новый материал / дизайн ламината Саржа Арборит
Победитель Новое решение с низким уровнем воздействия на окружающую среду Инис Мор Милликен
Новое решение с низким уровнем воздействия на окружающую среду Rinceau на Redux Trove
Победитель Новая обивка EvoFabric Размерный Концертекс
Новая обивка Коллекция иконок Sunbrella Ткани Glen Raven Custom
Победитель Неожиданное использование цемента, керамики и природных материалов в интерьере Коллекция Goede — Говорящие Ann Sacks
Неожиданное использование цемента, керамики и природных материалов в интерьере Покрытие для стен 3D / CB от Mac Stopa Массивная конструкция
Победитель Неожиданное использование стекла в интерьере EvoFabric Бусины Концертекс
Неожиданное использование стекла в интерьере Сверкающая жеода с бусами Майя Романофф

Сайт-специфическое включение 5′-метиловой ДНК усиливает терапевтический профиль гэпмерных ASO | Исследование нуклеиновых кислот

Аннотация

Недавно мы показали, что сайт-специфическое включение 2′-модификаций или нейтральных связей в область олигодезоксинуклеотидного разрыва токсичных фосфоротиоатных (PS) гэпмерных ASO может повысить терапевтический индекс и безопасность. В этой рукописи мы определили, может ли введение замены в 5′-положение дезоксинуклеотидных мономеров в промежутке также повысить терапевтический индекс. Введение R — или S -сконфигурированной 5′-Me ДНК в положения 3 и 4 в олигодезоксинуклеотидном промежутке усиливало терапевтический профиль модифицированных ASO, предполагая другое позиционное предпочтение по сравнению со стратегией модификации 2′-OMe промежутка. Общность этих наблюдений была продемонстрирована путем оценки R -5′-Me и R -5′-этил модификаций ДНК во множестве ASO, нацеленных на мРНК HDAC2, FXI и Dynamin2 в печени.Текущая работа дополняет растущее количество доказательств того, что небольшие структурные изменения могут модулировать терапевтические свойства PS ASO, и открывает новую эру химической оптимизации с акцентом на усиление терапевтического профиля в отличие от стабильности нуклеаз, сродства к РНК и фармакокинетических свойств. . ASO, модифицированные 5′-метиловой ДНК, продемонстрировали превосходную безопасность и антисмысловую активность у мышей, что подчеркивает терапевтический потенциал этого класса аналогов нуклеиновых кислот для конструкций ASO следующего поколения.

ВВЕДЕНИЕ

Химические модификации необходимы для улучшения лекарственных свойств терапевтических средств на основе нуклеиновых кислот (1,2). Исторически химические модификации использовались для повышения РНК-связывания и устойчивости к нуклеазам терапевтических средств на основе нуклеиновых кислот. Совсем недавно сайт-специфическое включение химических модификаций было использовано для усиления терапевтических свойств антисмысловых олигонуклеотидов (ASO) и терапевтических средств siRNA (3,4).

Недавно мы показали, что сайт-специфическое включение 2′-модификаций или нейтральных связей в область дезоксинуклеотидной пропасти токсичных фосфоротиоатных (PS) гэпмерных антисмысловых олигонуклеотидов (ASO) может повысить терапевтический индекс и безопасность (5).Мы предположили, что модификации 2′-или остова модулируют взаимодействия PS-ASO с важными клеточными белками, участвующими в токсичности, посредством модуляции стерической массы или конформации в непосредственной близости от остова PS. Мы также предположили, что введение замены в 5′-положение дезоксинуклеотидных мономеров в промежутке также может создавать стерическую массу или модулировать локальную конформацию в непосредственной близости от основной цепи PS и повышать безопасность (Рисунок 1). Чтобы проверить эту гипотезу, мы предприняли синтез и оценку гэпмерных ASO, в которых дезоксинуклеотиды в гэпе были заменены 5′-алкильными нуклеотидами ДНК сайт-специфическим образом.

Рисунок 1.

( A ) Структуры R- и S -5′-алкильных мономеров ДНК, оцененных в этой работе. ( B ) Структурная модель ASO, показывающая щелевое соединение 5′-cEt-ДНК. 5′-метильная группа в положении 3 в разрыве ДНК занимает то же химическое пространство, что и 2′-OMe группа в положении 2.

Рисунок 1.

( A ) Структуры R- и S -5′-алкильные мономеры ДНК оцениваются в данной работе.( B ) Структурная модель ASO, показывающая щелевое соединение 5′-cEt-ДНК. 5′-метильная группа в положении 3 в пробеле ДНК занимает то же химическое пространство, что и 2′-OMe группа в положении 2.

Семейство 5′-модифицированных аналогов нуклеиновых кислот обширно и может быть разделено на два основных структурные классы. Первый класс включает 5′-алкил ДНК или аналоги РНК, которые были оценены как улучшающие нуклеазную стабильность терапевтических средств на основе нуклеиновых кислот как на основе ДНК, так и на основе РНК (6–9). Было показано, что 5′-метиловые изомеры ДНК в области гэпа усиливают аллельную селективность PS ASO, нацеленных на однонуклеотидные полиморфизмы в зависимости от положения и конфигурации (10).Дополнительные варианты 5′-модифицированных нуклеиновых кислот включают 5′-метильные аналоги LNA, α-L-LNA и HNA (11–13). Изменение конфигурации 5′-алкильных заместителей в этих аналогах оказало значительное влияние на РНК-аффинность и иммуностимулирующие профили PS ASO (14). Второй класс 5′-модифицированных нуклеиновых кислот включает модификации, такие как бицикло- и трицикло-ДНК (15-17), α, β-CNA (18,19), аналоги с констрикцией остова (20,21) и двойные ограничения. LNA (22) и α-L-LNA (23), которые показывают значительное увеличение сродства к РНК и интересные биологические свойства (24,25).В этих аналогах 5′-заменитель ковалентно привязан для ограничения вращения вокруг нескольких углов скручивания основной цепи в зависимости от используемого режима ограничения. Кроме того, 5′-алкильные аналоги также использовались для модуляции стабильности и конформации 5′-фосфатной группы, чтобы облегчить загрузку siRNA в Ago2 (26).

В этой рукописи мы сообщаем о синтезе и оценке PS ASO, модифицированных как стереоизомерами 5′-метиловых, так и родственных 5′-алкильных нуклеотидов ДНК. 5′-метиловые нуклеотиды ДНК были включены в область дезоксинуклеотидного разрыва сайт-специфическим образом, и было охарактеризовано влияние на эффективность и цитотоксичность.Мы обнаружили, что обе конфигурации 5′-метиловой ДНК могут улучшать терапевтический профиль модифицированных PS ASO при включении в положения 3 и 4 в дезоксинуклеотидный разрыв, что позволяет предположить, что эти модификации имеют другое позиционное предпочтение по сравнению с 2′-OMe разрывом. стратегия модификации, описанная ранее (5). Кроме того, ASO 5′-метиловой ДНК могут иногда демонстрировать улучшенную эффективность по сравнению с ASO, модифицированными 2′-OMe и алкилфосфонатным разрывом, что подчеркивает терапевтический потенциал этого класса аналогов нуклеиновых кислот.

МАТЕРИАЛЫ И МЕТОДЫ

Синтез и очистка олигонуклеотидов

Олигонуклеотидов синтезировали в масштабе 40 мкмоль с использованием носителя Nittophase UnyLinker (317 мкмоль / г) на AKTA 10 Oligopilot. Полностью защищенные нуклеозидные фосфорамидиты были включены с использованием стандартного твердофазного олигонуклеотидного синтеза, то есть 15% дихлоруксусной кислоты в толуоле для деблокирования, 1 M 4,5-дицианоимидазол 0,1 M N -метилимидазол в ацетонитриле в качестве активатора для амидит-ацетиновых сочетаний, 20% в THF и 10% 1-метилимидазоле в THF / пиридине для кэппинга и 0. 1 М гидрид ксантана в смеси пиридин: ацетонитрил 1: 1 (об: об) для тиолирования. Связывания с 3-метоксипропилфосфонатом (MOP) окисляли вместо тиолирования с использованием 20% t-BuOOH в ACN. Амидиты растворяли до 0,1 М в смеси ацетонитрил: толуол 1: 1 (об: об) и включали в течение 6 мин. время рецикла связывания для амидитов ДНК и 10 мин. для всех остальных амидитов. В конце твердофазного синтеза цианоэтильные защитные группы удаляли на 30 мин. обработка 20% диэтиламином в толуоле. ASO с одним включением MOP могут быть сняты с защиты и отщеплены с помощью конц.водн. аммиак при комнатной температуре в течение 48 ч. Для множественных включений MOP использовали следующие мягкие условия снятия защиты:

Защищенный олигонуклеотид на носителе (400 мг) суспендировали в сухом ТГФ (5 мл) и перемешивали в течение 5 минут в стеклянном сосуде под давлением. Этилендиамин (EDA, 5 мл) добавляли шприцем при перемешивании при комнатной температуре. Реакционную смесь нагревали до 55 ° C при перемешивании (масляная баня) в течение 15 минут. Реакционную смесь охлаждали на ледяной бане и разбавляли ТГФ (5 мл). Реакционную смесь центрифугировали (300 об / мин, 5 мин) и растворитель удаляли пипеткой.Остаток промывали сухим ТГФ (2 × 5 мл). Осадок суспендировали в 50% EtOH и отработанную смолу удаляли фильтрацией. Фильтрат концентрировали при пониженном давлении.

Олигонуклеотиды очищали ионообменной хроматографией с использованием водных буферов со 100 мМ Nh5OAc и до 2 М NaBr. Группу DMT удаляли на колонке обработкой 6% дихлоруксусной кислотой в воде. Чистые фракции обессоливали на колонке с обращенной фазой C18, элюировали 50% ацетонитрилом в воде (об: об) и лиофилизировали.Чистоту и массу олигонуклеотидов определяли с помощью ион-парной ЖХМС. Аналитические данные для ASO представлены в дополнительной таблице S6.

Измерения термической денатурации

ASO и РНК были смешаны в соотношении 1: 1 (дуплекс 4 мкМ) в буфере, содержащем 100 мМ NaCl, 10 мМ фосфата и 10 мМ ЭДТА при pH 7. Олиго гибридизовали с комплементарной цепью РНК путем нагревания дуплекса до 85 ° C в течение 5 мин и дают остыть при комнатной температуре. Температуры термической денатурации (значения Tm) измеряли в кварцевых кюветах (длина пути 1.0 см) на ультрафиолетовом (УФ) / видимом спектрофотометре Cary 100, оборудованном терморегулятором Пельтье. Поглощение при 260 нм измеряли как функцию температуры с использованием линейного изменения температуры 0,5 ° C в минуту. T m значения были определены с использованием метода гиперхромности, включенного в программное обеспечение прибора.

Анализ активности ASO in vitro

клеток NIh4T3 смешивали с PS-ASO в указанных конечных концентрациях в конечном объеме 100 мкл и добавляли в высокопроизводительный планшет электропорации BTX.Затем клетки подвергали электропорации с использованием высокопроизводительной системы электропорации ECM 830. Через двадцать четыре часа после электропорации суммарную РНК получали с использованием RNeasy mini Kit (Qiagene). Целевые уровни мРНК были количественно определены с помощью количественного анализа ПЦР в реальном времени (qRT-PCR) с использованием системы TaqMan One-step qRT-PCR с реагентами AgPath-ID One-Step RT-PCR (Thermo Fisher Scientific). Вкратце, обратную транскрипцию выполняли при 45 ° C в течение 10 минут и останавливали нагреванием при 95 ° C в течение 10 минут. Впоследствии было проведено 40 циклов реакций кПЦР при 95 ° C в течение 15 секунд и 60 ° C в течение 60 секунд в каждом цикле.Данные qRT – PCR анализировали с помощью StepOne Software v.3 (Applied Biosystems). Уровни экспрессии РНК-мишени нормализовали к общей РНК в дублированных образцах РНК, количественно определяемых с использованием реагента Quant-iT RiboGreen RNA Reagent (Thermo Fisher Scientific). IC50 рассчитывали с использованием PRISM.

Анализ каспазы 3/7

Для количественного анализа активации каспаз реагент Caspase-Glo 3/7 (Promega) добавляли непосредственно к клеткам Hepa1-6 в 96- или 384-луночном планшете в объеме, равном объему образца. Люминесценцию регистрировали через 30 мин с помощью планшет-ридера TECAN Infinite M200. Вычитали фоновые показания, определенные для лунок, содержащих только культуральную среду. Относительную активность каспаз рассчитывали как 100% -ное значение люминесценции обработанного образца / показание люминесценции имитационно обработанного контроля.

Исследование связывания PS-ASO с белками

Отбор по аффинности связывающих белков с использованием биотинилированного 5–10–5 PS-MOE гэпмера PS-ASO, предварительно нанесенного на шарики нейтравидина, выполняли в основном, как описано (5).Связанные с гранулами белки затем элюировали путем конкуренции с 25 мкл 25 мкМ ASO той же последовательности, но разного дизайна, как показано в легенде к рисунку. Элюированные белки разделяли на 4–12% SDS-PAGE с последующим окрашиванием серебром с использованием набора для окрашивания серебром () в соответствии с протоколом производителя. Кроме того, белки в геле для ПААГ были перенесены на мембрану и обнаружены западным анализом. Мембраны блокировали 5% обезжиренным сухим молоком в 1 × PBS при комнатной температуре в течение 30 мин. Затем мембраны инкубировали с первичными антителами при комнатной температуре в течение 2 часов или при 4 ° C в течение ночи.После трех промывок 1 × PBS мембраны инкубировали с соответствующими вторичными антителами, конъюгированными с HRP (1: 2000), при комнатной температуре в течение 1 ч для проявления изображения с использованием субстрата Immobilon Forte Western HRP (Millipore). Первичные антитела, используемые для вестерн-анализа: P54nrb (sc-376865, Santa Cruz Biotech.), PSF (Sc-271796, Santa Cruz Biotech.), РНКаза h2 (15606-1-AP, ProteinTech), Ku70 (ab3114, Abcam). .

Иммунофлюресцентное окрашивание и комнфокальная визуализация

клеток HeLa, выращенных в чашках со стеклянным дном, трансфицировали в течение 2 ч 200 нМ ASO, используя Lipofactamine 2000 (Life Technologies), в соответствии с инструкциями производителя. Клетки промывали 1 × PBS, фиксировали 4% параформальдегидом в течение 0,5–1 ч при комнатной температуре и повышали проницаемость в течение 5 мин с помощью 0,1% тритона в 1 × PBS. После блокирования при комнатной температуре в течение 30 минут с помощью 1 мг / мл BSA в 1 × PBS клетки инкубировали с антителом (sc-376865, Santa Cruz Biotech, 1: 200) против P54nrb в блокирующем буфере (1 мг / мл BSA в 1 × PBS) в течение 2 часов, трижды промывали (по 5 минут) 0,1% нонилфеноксиполиэтоксилэтанолом-40 (NP-40) в 1 × PBS и инкубировали в течение 1 часа со вторичным антителом, конъюгированным с AF488 (1: 200).После трехкратной промывки клетки закрепляли реагентом против выцветания, содержащим DAPI (Life Technologies), и изображения получали с помощью конфокального микроскопа (Olympus FV-1000) и обрабатывали с помощью программного обеспечения FV-10 ASW 3.0 Viewer (Olympus). Клетки подсчитывали вручную на те, которые содержали неправильно локализованные белки P54nrb.

Анализ расщепления РНКазой h2

Очищенную человеческую РНКазу h2 разводили в буфере, содержащем 100 мМ Трис-HCl, pH 7,4, 50 мМ NaCl, 30% глицерин и 10 мМ DTT. Дуплекс ASO / РНК был сформирован с ASO и 5′-FAM-меченной комплементарной РНК в конечной концентрации 0,33 мкМ каждая путем отжига в реакционном буфере, содержащем 20 мМ Tris-HCl, pH 7,4, 50 мМ NaCl, 10 мМ MgCl 2 и 10 мМ DTT. Белок РНКазы h2 добавляли к дуплексу до конечной концентрации 1 нг на реакцию и реакционную смесь инкубировали при 37 ° C в течение 15 минут. Реакцию останавливали добавлением 10 мкл стоп-раствора, содержащего 8 М мочевину и 120 мМ ЭДТА, на каждые 20 мкл реакционной смеси. Образцы нагревали при 95 ° C в течение 5 минут и разделяли на 20% денатурирующем полиакриламидном геле, а продукты расщепления визуализировали с помощью Storm PhosphorImager и анализировали с помощью программного обеспечения ImageQuantTL.

In vivo исследования

Эксперименты на животных проводились в соответствии с руководящими принципами Американской ассоциации по аккредитации лабораторных животных и были одобрены Комитетом по благополучию животных (руководящие принципы Институционального комитета по уходу и использованию животных лаборатории Колд-Спринг-Харбор). Самцы мышей BALB / c в возрасте 6-8 недель были получены от Charles River Laboratories. Если не указано иное, для обработки использовали трех животных.Животные были случайным образом сгруппированы, и все животные были включены в анализ данных (если животные не были обнаружены мертвыми до конца исследования). PS-ASO или физиологический раствор вводили подкожно. Через 72 часа после инъекции животных анестезировали 2–4% изофлураном и собирали кровь путем пункции сердца или кровотечения из хвоста. Образцы крови обрабатывали до плазмы и оценивали на АЛТ с использованием биоанализатора Beckman Coulter AU480. Образцы печени гомогенизировали в изотиоцианате гуанидиния с 8% бета-меркаптоэтанолом, и общую РНК получали с использованием набора для очистки РНК RNeasy (Qiagen) или Purelink (Thermo Fisher Scientific).Уровни мРНК количественно определяли с помощью qRT-PCR с использованием наборов праймерных зондов TaqMan с набором EXPRESS One-Step Superscript ™ qRT-PCR Kit. Данные qRT – PCR анализировали с помощью StepOne Software v. 3 (Applied Biosystems). Уровни экспрессии РНК-мишени оценивали с повторением методики и нормализовали по общей РНК, количественно определяемой с помощью реагента Quant-iT RiboGreen RNA Reagent (Thermo Fisher Scientific). Средние значения и стандартное отклонение были рассчитаны для трех разных мышей в каждой группе. ЕС50 рассчитывали с использованием программного обеспечения GraphPad PRISM.

Наборы праймер-зондов, используемых для qRT-PCR

9075 CACAAGCAT-3 ‘ 9075GATGATGTACGAC-3 ‘ 9075GAT
Мышь FXI
Вперед: 5′-ACATGACAGGCGCGATCTCT-3 ′
Обратный: 5′-CTAC2 ′ -TTCCTTCAAGCAATGCCCTCAGCAAT-3 ‘
Мышь Cxcl12
Вперед: 5′-CCAGAGCCAACGTCAAGCAT-3′
66 Зонд : 5′-TGAAAATCCTCAACACTCCAAACTGTGCC-3 ‘
Мышь Hdac2
Вперед: 5′-TGATGGTGTTGAGTAG3 9075-3TGATGTGTTGAGTAG3 9075-3TGATGGTGTT75TAGTAG3
Зонд: 5′-ACAACAGATCGCGTGATGACCGTCTC-3 ‘
Мышь Dynamin 2 9 0753
Вперед: 5′- AGAGGAGACCGAGCGAAT-3 ‘
Обратный: 5′- CATGGTTTGTGTTGATGTACGAC-3′ 66 9075GATGACGAC-3′ 66 9075GATC
9075 9075GATC1 ACGAC1 9075GATC1 9075GATC1 9075GATC1 9075GATGTACGAC-3 ‘ 9075GATGTACGAC-3′
Мышь FXI
Вперед: 5′-ACATGACAGGCGCGATCTCT-3 ‘
TCTACCbe ′ -TTCCTTCAAGCAATGCCCTCAGCAAT-3 ′
Мышь Cxcl12
Вперед: 5′-CCAGAGCCAACGTCAAGCAT-3 ‘
Зонд: 5′-TGAAAATCCTCAACACTCCAAACTGTGCC-3 ‘
Мышь Hdac2
Вперед: 5′-TGATGGTGTTGAGGAAGCTTTTT-3 ′
Обратный: 5′-TCCCTCAAGTCTCCTGTTCCA-3 ′
ACGTC1
Вперед: 5′- AGAGGAGACCGAGCGAAT-3 ‘
Обратный: 5′- CATGGTTTGTGTGTTGATGTACGAC-3′
ACTCTCCTGTTCCA-3 ‘ 9075GATTC ACTC
Мышь FXI
Вперед: 5′-ACATGACAGGCGCGATCTCT-3 ‘
9075AC3 TCGTAGC Обратный: 5′ 5′-TTCCTTCAAGCAATGCCCTCAGCAAT-3 ‘
Мышь Cxcl12
Forwa rd: 5′-CCAGAGCCAACGTCAAGCAT-3 ‘
Обратный: 5′-CAGCCGTGCAACAATCTGAA-3′
Зонд: 5′-TGAA143AATCCACTCAAC3
Вперед: 5′-TGATGGTGTTGAGGAAGCTTTTT-3 ‘
Обратный: 5′-TCCCTCAAGTCTCCTGTTCCA-3′
Dynamin 2
Вперед: 5′- AGAGGAGACCGAGCGAAT-3 ‘
Обратное: 5′- CATGGTTTGTGTGTTGATGTAC3GAC3 9075GTGATGTACGAC3 9075GC 9075GA 9075GC 9075GC 9075GC 9075GA 9075GC 9075GC 9075GC 9075GCAGC
9075 Dynamics
Мышь FXI
Вперед: 5′-ACATGACAGGCGCGATCTCT-3 ‘
Реверс: 5′-TCTAGGTTCACGTACACATCTTTGC-3 ‘
Зонд мыши: 5′-TTCCTTCAAGCAATGCCCTCAGCAAT-3′

-CCAGAGCCAACGTCAAGCAT-3 ‘
Обратный: 5′-CAGCCGTGCAACAATCTGAA-3′
Зонд: 5′-TGAAAATCCTCAAC142CCAAACTG
Вперед: 5′-TGATGGTGTTGAGGAAGCTTTTT-3 ‘
Обратный: 5′-TCCCTCAAGTCTCCTGTTCCA-3′
ACGACTC1 ACGACGATC1 ACGACGATC1 Зонд: 5′-GATC3
Вперед: 5′- AGAGGAGACCGAGCGAAT-3 ′
Назад: 5 ′ — CATGGTTTGTGTTGATGTACGAC-3 ′
Зонд: 5′- CCTACATCAGGGAGCGAGAAGGGA-3 ′

РЕЗУЛЬТАТЫ

Синтез

R — и S -5′-метил-ДНК-нуклеозид фосфорамидитов, исходя из диацетоновой глюкозы

Синтез R — и S -5′-метил-ДНК тимидинфосфорамидитов описан на рисунке 2. Промежуточный продукт 1 сахара был получен в количествах, составляющих несколько граммов, в 5 стадий, начиная с диацетоновой глюкозы, и был ключевым промежуточным продуктом для стереоселективного синтеза 5′-метил нуклеозидов ДНК (дополнительная схема S1). 1 подвергали ацетолизу с использованием уксусной кислоты и концентрированной серной кислоты в этилацетате с получением соответствующего бис-ацетата, который затем подвергали реакции Ворбруггена (27) с использованием пер-силилированного тимина для получения нуклеозида 2. 2′- O -ацетатная группа была выборочно удалена в присутствии бензоильной группы с использованием холодного метанольного аммиака с последующей деоксигенацией Бартона (28) с получением 2′-дезоксинуклеозида 5.С 3′- O -бензильной группы сняли защиту с использованием трихлорида бора, чтобы получить 6, который был дополнительно защищен как 3′- O — ( трет -бутилдиметилсилил) эфир с получением 7. 5′- O С -бензоильной группы сняли защиту с использованием карбоната калия в метаноле, чтобы получить 8, с последующей защитой в виде 4,4′-диметокситритилового (DMTr) эфира, чтобы получить 9. Удаление 3′- O — ( трет -бутилдиметилсилил) защитная группа предоставила нуклеозид 10, который фосфитилировали с получением желаемого R -5′-метил ДНК тимидинфосфорамидита 11.Стереохимия в 5′-положении была подтверждена рентгеновской кристаллографией после снятия защиты с 3′- O трет -бутилдиметилсилильной группы в нуклеозиде 8 (дополнительный рисунок S1 и таблицы S1 – S6).

Рисунок 2.

Синтез R — и S -5′-Me ДНК нуклеозид фосфорамидитов

Рисунок 2.

Синтез R — и S -5′-Me ДНК нуклеозид фосфорамидитов

Синтез S -5′-метил ДНК тимидинфосфорамидита был осуществлен путем инверсии вторичной 5′-гидроксильной группы в 8 с использованием реакции Мицунобу (29) с p -нитробензойной кислотой.Снятие защиты с 5′- O — ( p -нитробензоил) группы дало 13, которая была дополнительно защищена как DMTr эфир и подвергалась десилилированию для удаления 3′- O — ( трет -бутилдиметилсилил), защищающего группу, чтобы получить 15. Фосфитилирование 15 дало R -5′-Me ДНК тимидин фосфорамидит 16. Синтез 5-Me цитозина, аденозина и аналогов гуанозина осуществляли с использованием аналогичных процедур, описанных в дополнительных схемах S2-S7.Синтез 5′-этилнуклеозидных мономеров (дополнительные схемы S8 – S10) и 5′-аллильных нуклеозидных мономеров (дополнительные схемы S11-S14) также был осуществлен, как описано в дополнительной информации (30-33).

Влияние сайт-специфического включения

R — и S -5′-метил ДНК на термостабильность дуплекса, активность ASO и токсичность в клетках

Мы оценили эффект замены каждого дезоксинуклеотида PS в области гэпа ION 558807 — модельного гепатотоксичного ASO — на R — и S -5′-метил-мономеры ДНК. R — и S -5′-метил-ДНК-фосфорамидиты были включены в гэпмерные ASO с использованием стандартной автоматизированной химии, и полученные ASO были оценены в измерениях дуплексной термостабильности для определения аффинности связывания РНК и в клетках для воздействия на антисмысловую активность и цитотоксичность.

Включение одной модификации S -5′-метил ДНК в разрыв привело к минимальным изменениям термостабильности дуплекса (в среднем –0,3 ° C / мод.) По сравнению с контрольным ASO (рис. 3A).Эти результаты согласуются с нашими предыдущими данными о том, что S -5′-метил-LNA проявляет значительно улучшенную способность к образованию дуплексов по сравнению со стереоизомером R -5′-метил LNA (11). Напротив, включение единственной модификации R -5′-метил ДНК в разрыв приводило к умеренной дестабилизации (в среднем –2,6 ° C / мод.) По сравнению с ASO родительского контроля (рис. 3C). Однако все модифицированные ASO проявляли превосходную стабильность дуплекса в сочетании с комплементарной РНК, что свидетельствует об отсутствии значительных изменений в способности этих ASO образовывать дуплекс.

Фигура 3.

( A ) 5′- S -Me ДНК ( C ) 5′- R -Me ДНК-мономеры проходили через область гэпа и влияли на стабильность дуплекса по сравнению с комплементарной РНК, Определяли антисмысловую активность в клетках NIh4T3 и цитотоксичность, измеренную по активации каспазы в клетках Hepa1-6. Неправильную локализацию P54nrb выявляли иммунофлуоресцентным окрашиванием в клетках Hela. Процент клеток, содержащих неправильно локализованный белок P54nrb, был рассчитан на основе ручного подсчета ~ 100 клеток.Кривые доза-ответ для восстановления мРНК CXCl12 в NIh4T3 после доставки ( B ) 5′- S -Me ДНК и ( D ) 5′- R -Me ДНК клеток ASO путем электропорации. Синие буквы указывают на ограниченный этил (cEt), черные указывают на ДНК, а красные указывают на 5′-алкильные нуклеотиды ДНК. Все ASO были полностью модифицированы фосфоротиоатом (PS).

Рисунок 3.

( A ) 5′- S -Me ДНК ( C ) 5′- R -Me ДНК-мономеры проходили через область гэпа и влияли на стабильность дуплекса по сравнению с комплементарной РНК определяли антисмысловую активность в клетках NIh4T3 и цитотоксичность, измеренную по активации каспазы в клетках Hepa1-6.Неправильную локализацию P54nrb выявляли иммунофлуоресцентным окрашиванием в клетках Hela. Процент клеток, содержащих неправильно локализованный белок P54nrb, был рассчитан на основе ручного подсчета ~ 100 клеток. Кривые доза-ответ для восстановления мРНК CXCl12 в NIh4T3 после доставки ( B ) 5′- S -Me ДНК и ( D ) 5′- R -Me ДНК клеток ASO путем электропорации. Синие буквы указывают на ограниченный этил (cEt), черные указывают на ДНК, а красные указывают на 5′-алкильные нуклеотиды ДНК.Все ASO были полностью модифицированы фосфоротиоатом (PS).

Модифицированные ASO также оценивали на антисмысловую активность в клетках 3T3 мыши после доставки электропорацией, где все они проявляли сравнимую активность (в пределах 2-кратного IC 50 ) с исходным ASO (рис. 3A – D). ASO также оценивали на цитотоксичность в клетках Hepa1-6 с использованием анализа каспазы, как описано ранее (5). Исходная модель токсичного ASO ION558807 продемонстрировала резкое увеличение активации каспаз, которое было смягчено путем введения мономера ДНК S -5′-Me ДНК в положение 3 в промежутке или с мономером ДНК R -5′-Me в положении 4 в разрыв. Это позиционное предпочтение отличалось от 2′-аналогов, таких как OMe, которые снижают токсичность, когда присутствуют в положении 2 в пробеле ДНК (5). Предпочтение положений 3 и 4 для снижения токсичности было также подтверждено в анализе неправильной локализации P54, где введение ДНК S -5′-Me в положение 3 и ДНК R -5′-Me в положение 4 показало снижение неправильной локализации ядрышек. P54 (Рисунок 3A, C и дополнительный рисунок S2). Мы также оценивали ASO с OMe в положении 2 разрыва и ДНК 5′-Me в положении 3 разрыва, но объединение двух модификаций не дало преимуществ по сравнению с использованием модификаций по отдельности, и в результате эти ASO больше не оценивались.

Влияние сайт-специфического включения 5′-метиловой, 5′-аллильной и 5′-этильной ДНК на активность и гепатотоксичность у мышей

ASO с различными аналогами 5′-алкильной ДНК оценивали на мышах, чтобы охарактеризовать влияние размера, конфигурации и размещения мономеров 5′-алкильной ДНК на активность и гепатотоксичность у мышей. Модель токсичного исходного ASO 558807 и вариант с 3-метоксипропилфосфонатом (MOP) в положении 2 разрыва были включены в качестве контроля. Мышам подкожно вводили возрастающие дозы ASO, замещенных R — или S -5′-метил ДНК, R — или S -5′-аллильной ДНК в положениях 3 и 4 промежутков.Через 72 часа после инъекции животных умерщвляли, печень гомогенизировали и определяли снижение мРНК CXCl12 с помощью количественной ОТ-ПЦР. Уровни аланинаминотрансферазы (ALT) в плазме также измеряли во время умерщвления. Большинство ASO, модифицированных 5′-метиловой ДНК R и S , проявляли сравнимую эффективность, но значительно снижали токсичность даже при самой высокой дозе 150 мг / кг по сравнению с исходным ASO 558807, который может быть летальным при введении при дозах выше 50 мг / кг (рис. 4A и B).Интересно, что ASO с R -5′-Me ДНК в положении 3 или S -5′-Me в положении 4 демонстрировали повышение ALT, что наводит на мысль о позиционном предпочтении этих модификаций, зависящем от конфигурации. Напротив, ASO, модифицированные R — и S -5′-аллил ДНК, не демонстрировали повышения АЛТ даже при максимальной дозе 150 мг / кг, но были немного менее эффективными, чем исходный ASO.

Рис. 4.

Характеризация эффекта вставки мономеров R — и S -5′-Me ДНК и 5′-аллильной ДНК в положениях 3 и 4 ( A и B ) и ( C и D ) положение 2 в пробеле ДНК в зависимости от активности, определяемой дозой, необходимой для снижения мРНК CXCL12 на 50% в печени по сравнению с необработанными контрольными животными (ED 50 ), и гепатотоксичности, измеренной по увеличению уровня ALT в плазме. (МЕ / л) у мышей.( E и F ). Характеристика влияния введения мономеров ДНК R — и S -5′-этил в положения 3 и 4 в пробеле ДНК на активность и гепатотоксичность у мышей. Для определения ED 50 мышам (Balb / c, n = 3 / группа) вводили подкожно ASO (50, 16,7, 5,6 и 1,9 мг / кг) и подвергали эвтаназии через 72 часа. Собирали печень и измеряли уменьшение мРНК CXCl12 с помощью qRT-PCR. Что касается ALT в плазме, мышам (Balb / c, n = 3 / группа) вводили подкожно 150 мг / кг ASO и умерщвляли через 72 часа, а значения ALT измеряли на клиническом анализаторе.Синие буквы указывают на ограниченный этил (cEt), черные указывают на ДНК, а красные указывают на 5′-алкильные нуклеотиды ДНК. Все ASO были полностью модифицированы фосфоротиоатом (PS).

Рис. 4.

Характеристика эффекта вставки мономеров R — и S -5′-Me ДНК и 5′-аллильной ДНК в положениях 3 и 4 ( A и B ) и ( C и D ) положение 2 в пробеле ДНК в зависимости от эффективности, определяемой дозой, необходимой для снижения мРНК CXCL12 на 50% в печени по сравнению с необработанными контрольными животными (ED 50 ), и гепатотоксичности, измеряемой по увеличению в плазме АЛТ (МЕ / л) у мышей.( E и F ). Характеристика влияния введения мономеров ДНК R — и S -5′-этил в положения 3 и 4 в пробеле ДНК на активность и гепатотоксичность у мышей. Для определения ED 50 мышам (Balb / c, n = 3 / группа) вводили подкожно ASO (50, 16,7, 5,6 и 1,9 мг / кг) и подвергали эвтаназии через 72 часа. Собирали печень и измеряли уменьшение мРНК CXCl12 с помощью qRT-PCR. Что касается ALT в плазме, мышам (Balb / c, n = 3 / группа) вводили подкожно 150 мг / кг ASO и умерщвляли через 72 часа, а значения ALT измеряли на клиническом анализаторе.Синие буквы указывают на ограниченный этил (cEt), черные указывают на ДНК, а красные указывают на 5′-алкильные нуклеотиды ДНК. Все ASO были полностью модифицированы фосфоротиоатом (PS).

Мы также определили эффект введения R — и S -5′-метила и 5′-аллила ДНК в положение 2 разрыва, чтобы подтвердить, будут ли эти ASO быть гепатотоксичными у мышей, как это было предсказано анализами клеточной цитотоксичности ( Рисунок 3A и C). Ранее было показано, что замещение в положении 2 на 2′-OMe способствует значительному снижению токсичности нескольких сотен гэпмерных ASO cEt (5).5′-аллильный мономер был синтезирован как смесь изомеров, поскольку он не смог стереоселективно ввести этот заместитель в 2′-дезоксигуанозиновые нуклеозиды (дополнительная схема S14). Мышам вводили подкожно возрастающие дозы ASO и умерщвляли через 72 часа после инъекции. Было обнаружено, что оба 5′-метиловых ДНК ASO токсичны для мышей, что позволяет предположить, что эти аналоги имеют различное позиционное предпочтение в промежутке для снижения токсичности по сравнению с аналогами, модифицированными 2′- и основной цепью (рис. 4C и D).В соответствии с данными животных, ASO с R — и S -5′-аллил ДНК в положениях 3 и 4 показали пониженное связывание с белком и неправильную локализацию P54 по сравнению с ASO с 5′-аллильной ДНК в положении 2 или бициклоДНК в положениях. 3 и 4 (дополнительные рисунки S3 и S4).

Наконец, учитывая более сильный эффект снижения токсичности, наблюдаемый у аналога 5′-аллильной ДНК, мы исследовали, может ли 5′-этильная ДНК улучшить эффективность по сравнению с 5′-аллильной ДНК, но снизить токсичность, иногда наблюдаемую при высоких дозах ASO. с 5′-метиловыми аналогами ДНК.Фосфорамидиты R — и S -5′-этилнуклеозида были синтезированы, как описано в дополнительных схемах S11-S14. Мономеры были включены в положения 3 и 4 в области промежутка ASO 558807, и модифицированные ASO были оценены на эффективность и токсичность на мышах. Как R -, так и S -5′-этильная ДНК снижали гепатотоксичность, наблюдаемую с родительским ASO, и, будучи помещенными в положение 4 разрыва, были немного более эффективными, чем контрольный ASO 3, который содержит 2′-OMe в положении разрыва. позиция 2 родительского ASO 558807 (рис. 4E и F).

Влияние сайт-специфического включения 5′-метил- и 5′-этильной ДНК на активность и гепатотоксичность для множественных гепатотоксических последовательностей ASO

Учитывая, что ASO с R -5′-алкильной ДНК были немного более мощными, чем ASO с S -5′-алкильными заменами ДНК, и из-за немного более короткого пути синтеза R -5′-Me ДНК мономеров, мы определили эффект введения R -5′-метил ДНК и R -5′-этил ДНК в дополнительных токсичных последовательностях ASO. Мы выбрали пять гепатотоксических ASO, нацеленных на мРНК мышиных FXI, HDAC2 и Dynamin2, для оценки на мышах и сравнили их с контрольными ASO с заменой 2′-OMe или MOP в положении 2 разрыва (рис. 5A). Исходные 3–10–3 гэпмерных ASO не были включены в эту оценку, поскольку ранее было показано, что они токсичны для мышей (5).

Рис. 5.

( A ) Сравнение влияния введения 2′-OMe, MOP, R -5′-метил и R -5′-этил модификаций ДНК на эффективность и гепатотоксичность ASO, нацеленных на HDAC2 , МРНК FXI и Dynamin 2 (средняя ALT = 27 ± 5 МЕ / л для группы PBS).( B – F ) Кривые доза-ответ для снижения целевой мРНК в печени мышей. Мышам (Balb / c, n = 3 / группа) вводили подкожно ASO (150, 50, 16,7, 5,6 и 1,9 мг / кг) и умерщвляли через 72 часа. Собирали печень и измеряли снижение уровней целевых мРНК с помощью qRT-PCR. Значения АЛТ в плазме измеряли на клиническом анализаторе по окончании исследования. Данные, отмеченные звездочкой, были собраны из другого эксперимента с использованием того же дизайна исследования, что и указано выше. Синие буквы указывают на ограниченный этил (cEt), черные указывают на ДНК, а красные указывают на 5′-алкильные нуклеотиды ДНК. Все ASO были полностью модифицированы фосфоротиоатом (PS).

Рис. 5.

( A ) Сравнение влияния введения модификаций ДНК 2′-OMe, MOP, R -5′-метила и R -5′-этила на эффективность и гепатотоксичность нацеленных на ASOs МРНК HDAC2, FXI и Dynamin 2 (средняя ALT = 27 ± 5 МЕ / л для группы PBS). ( B – F ) Кривые доза-ответ для снижения целевой мРНК в печени мышей.Мышам (Balb / c, n = 3 / группа) вводили подкожно ASO (150, 50, 16,7, 5,6 и 1,9 мг / кг) и умерщвляли через 72 часа. Собирали печень и измеряли снижение уровней целевых мРНК с помощью qRT-PCR. Значения АЛТ в плазме измеряли на клиническом анализаторе по окончании исследования. Данные, отмеченные звездочкой, были собраны из другого эксперимента с использованием того же дизайна исследования, что и указано выше. Синие буквы указывают на ограниченный этил (cEt), черные указывают на ДНК, а красные указывают на 5′-алкильные нуклеотиды ДНК. Все ASO были полностью модифицированы фосфоротиоатом (PS).

Для первого набора ASO, нацеленных на мРНК HDAC2, мышам вводили подкожно возрастающие дозы ASO, модифицированных разрывом. Животных умерщвляли через 72 часа после введения ASO, и снижение количества мРНК HDAC2 в печени количественно определяли с помощью qRT-PCR. Уровни АЛТ в плазме также измеряли во время умерщвления. Все ASO с модифицированным разрывом не проявляли явной гепатотоксичности при дозировке до 150 мг / кг, но ASO с R -5′-метил ДНК в положении 3 разрыва показал лучшую эффективность (фиг. 5A и B).Сходные результаты были получены для второй последовательности HDAC2, где ASO с R -5′-метил ДНК в положении 3 разрыва и ASO с 2′-OMe в положении 2 разрыва показали лучшую эффективность (фиг. 5C).

Затем мы оценили ASO, нацеленные на мРНК FXI мыши. Мышам подкожно вводили увеличивающиеся дозы модифицированных ASO, и после умерщвления количественно определяли уменьшение мРНК FXI в печени. Как видно из приведенных выше ASO HDAC2, все ASO с модифицированным разрывом не проявляли явной гепатотоксичности при максимальной дозе 150 мг / кг (рис. 5A).В первом наборе ASO с 5′-алкильной ДНК показали эффективность, сравнимую с ASO с 2′-OMe в положении 2 в одной последовательности (рис. 5D). Для второго токсичного FXI ASO мы оценивали только ASO с заменой R -5′-метил ДНК, и лучшая эффективность наблюдалась, когда эта модификация была включена в положение 4 в дезоксинуклеотидном промежутке (рис. 5E).

Наконец, мы оценили влияние модификаций гэпа на эффективность и токсичность, используя гэпмер ASO, нацеленный на мРНК Dynamin2 (рис. 5A).Мышам вводили возрастающие дозы ASO, и после умерщвления измеряли снижение уровня мРНК в печени и уровни ALT в плазме. В этой серии ASO с R -5′-метилом в положениях 3 и 4 разрыва показали превосходную эффективность, в то время как ASO с R -5′-этил ДНК в том же положении были менее активными (фиг. 5F). Все ASO были безопасны при дозировке 150 мг / кг.

Влияние

R — и S -5′-метил ДНК на паттерны расщепления RNaseh2

Мы исследовали влияние введения R — и S -5′-метил ДНК в область гэпа 558807 на паттерны расщепления RNaseh2 рекомбинантным полноразмерным ферментом человека (34). ASO подвергали дуплексу с меченной 5′-FAM комплементарной РНК, и гетеродуплексы подвергали расщеплению с помощью RNaseh2. Продукты расщепления разделяли на денатурирующем геле и определяли сайты расщепления на РНК. RNaseh2 продуцирует шесть различных сайтов расщепления на РНК для родительского ASO 558807, которые были обозначены a – f соответственно (рис. 6A). Введение R и S -5′-метил ДНК оказало положительный эффект на паттерны расщепления, который можно лучше понять, посмотрев на положение каждой модификации в пределах отчетливого, но перекрывающегося семинуклеотидного следа каталитический домен RNaseh2 для каждого сайта расщепления на РНК (рис. 6B) (35).

Рисунок 6.

( A ) Характеризует эффект введения мономеров ДНК R- и S-5′-Me в разрыв на паттерны расщепления RNaseh2 дуплексов ASO / РНК. ( B ) Структурная модель, показывающая 7-элементный след каталитического домена рекомбинантной человеческой РНКазыh2 для сайтов расщепления a-f на дуплексе ASO / РНК. ( C ) Включение S -5′-Me ДНК в положение 8 в разрыв ДНК устраняет сайт расщепления a , в то время как включение R -5′-Me ДНК в положения 8 и 9 удаляет сайт расщепления а на дуплексе ASO / РНК.( D ) Структурная модель, показывающая, как заместители 5′-Me могут модулировать важные контакты скелета между Arg 179, Ile239 и Trp225 на человеческой РНКseh2 и сахарно-фосфатным скелетом ASO. ( E ) Проекции Ньюмана, изображающие, как конфигурация 5′-метильной группы может изменять предпочтение вращения вокруг угла кручения γ сахарофосфатного остова. Синие буквы указывают на ограниченный этил (cEt), черные указывают на ДНК, а красные указывают на 5′-алкильные нуклеотиды ДНК. Все ASO были полностью модифицированы фосфоротиоатом (PS).

Рисунок 6.

( A ) Характеризует эффект введения мономеров R- и S-5′-Me ДНК в разрыв на паттерны расщепления RNaseh2 дуплексов ASO / РНК. ( B ) Структурная модель, показывающая 7-элементный след каталитического домена рекомбинантной человеческой РНКазыh2 для сайтов расщепления a-f на дуплексе ASO / РНК. ( C ) Включение S -5′-Me ДНК в положение 8 в разрыв ДНК устраняет сайт расщепления a , в то время как включение R -5′-Me ДНК в положения 8 и 9 удаляет сайт расщепления а на дуплексе ASO / РНК.( D ) Структурная модель, показывающая, как заместители 5′-Me могут модулировать важные контакты скелета между Arg 179, Ile239 и Trp225 на человеческой РНКseh2 и сахарно-фосфатным скелетом ASO. ( E ) Проекции Ньюмана, изображающие, как конфигурация 5′-метильной группы может изменять предпочтение вращения вокруг угла кручения γ сахарофосфатного остова. Синие буквы указывают на ограниченный этил (cEt), черные указывают на ДНК, а красные указывают на 5′-алкильные нуклеотиды ДНК. Все ASO были полностью модифицированы фосфоротиоатом (PS).

Влияние модификаций на паттерны расщепления можно проиллюстрировать, посмотрев на сайты, где R — и S -5′-метил ДНК вызывают удаление основного сайта расщепления a на РНК (фигура 6C). R -5′-метил ДНК вызывает удаление сайта расщепления а при введении в положения 8 или 9 в разрыве ДНК (положения 4 и 5 в семинуклеотидном следе). Напротив, S -5′-метил ДНК вызывает удаление сайта расщепления а только при включении в положение 8 в разрыв ДНК (положение 4 в семинуклеотидном следе).

Результаты анализа расщепления можно рационализировать, исследуя кристаллическую структуру каталитического домена РНКазы человека 2 (рис. 6D) (36). Фермент устанавливает три важных контакта с остовом ДНК с Arg179 в фосфатсвязывающем кармане в положении 3 в отпечатке, амидом остова Ile239 в положении 4 в отпечатке и кольцом-NH Trp225 в положении 5 в отпечатке. Введение R — и S -5′-метил ДНК в положение 4 может препятствовать двум важным контактам (Arg179 и Ile 239), приводя к устранению расщепления. Интересно, что введение R -5′-метиловой ДНК в положение 5 может мешать контакту основной цепи, осуществляемому Trp225, поскольку эта метильная группа указывает в направлении индольного кольца. Напротив, S -5′-метильная группа направлена ​​от индольного кольца и, по-видимому, не мешает этому важному контакту в положении 5 следа.

Следует также отметить, что введение замещения в 5′-положение нуклеозидных мономеров может вызвать конформационные изменения вокруг торсионного угла гамма (γ) сахарофосфатного остова (рис. 6E) (37).Существует по крайней мере три различные конформации вокруг γ, где 5′-атом кислорода находится либо в ориентации gauche с кольцевым атомом кислорода (γ в диапазонах + sc и ap ), или где два атома кислорода находятся в ориентации анти (γ в диапазоне — sc ). Предыдущая работа показала, что введение метильных групп в 5′-положение может изменить конформационное равновесие вокруг γ, при этом + sc является предпочтительной ориентацией для S -5′-метила и ap является предпочтительной для R -5. ‘-Метил (11,13).Таким образом, эффекты на паттерны расщепления также могут быть результатом изменений конформационных предпочтений вокруг углов скручивания основной цепи в дополнение к неблагоприятным стерическим контактам, как обсуждалось выше.

ОБСУЖДЕНИЕ

PS За последнее десятилетие терапевт ASO добился огромных успехов. На сегодняшний день шесть PS ASO были одобрены регулирующими органами, а еще 45 PS ASO проходят клиническую оценку по показаниям от редких генетических заболеваний до широких сердечно-сосудистых заболеваний (38).Параллельно с этим были достигнуты значительные успехи в нашем понимании того, как PS ASO взаимодействуют с плазмой, клеточной поверхностью и клеточными белками для дальнейшего улучшения профиля PS ASO для терапевтического применения (39,40).

Недавно мы показали, что токсичные ASO cEt gapmer связывают параспекл-белки, такие как P54nrb, FUS и PSF, более прочно, чем нетоксичные ASO, и вызывают неправильную локализацию ядрышек, что приводит к цитотоксичности в клетках и гепатотоксичности у мышей (5). Мы также показали, что простые химические стратегии, такие как введение нуклеозидов 2′-OMe или алкилфосфонатной связи в положение 2 в разрыве ДНК, могут уменьшить эти токсические эффекты и улучшить терапевтический индекс у животных (3).Однако эти стратегии привели к умеренному (2-кратному) снижению антисмысловой активности некоторых последовательностей ASO. В этом исследовании мы изучали, может ли введение небольших структурных изменений в других положениях вдоль сахарно-фосфатного остова также увеличить TI токсичных cEt гэпмерных ASO, сохраняя при этом эффективность по сравнению с исходным ASO.

Учитывая точную природу SAR для уменьшения токсичности (около положений 2–3 в дезоксинуклеотидном промежутке), мы исследовали эффект введения замены в 5′-положение нуклеозидных мономеров.5′-положение представляет собой интересный сайт для введения замещения, так как оно находится в непосредственной близости от связи PS, и конфигурация замещающей группы может изменять конформационную динамику вокруг одного или нескольких торсионных углов основной цепи сахарного фосфатного остова. Интересно, что группа заместителей в 5′-положении должна занимать такое же химическое пространство, как 2′-заместитель в 5′-соседнем нуклеотиде в ASO (рис. 1B).

Нуклеозиды R — и S -5′-метил ДНК были включены в каждое положение разрыва ДНК, и модифицированный ASO был оценен в экспериментах по дуплексной термостабильности и на антисмысловую активность и цитотоксичность в клетках.В целом, введение любой модификации хорошо переносилось и приводило к умеренному снижению термостабильности дуплекса по сравнению с комплементарной РНК (от –0,3 до –2,3 ° C / модификация). Все ASO также проявляли хорошую активность в клетках, сравнимых с исходным ASO, но только ASO с модификациями в положениях 3 и 4 в промежутке показали значительно сниженную цитотоксичность.

Чтобы подтвердить эти результаты на мышах, мы исследовали влияние введения R — и S -5′-метил ДНК в положениях 2, 3 и 4 в промежутке на гепатотоксичность и активность в печени.Согласно данным клеточной цитотоксичности, введение 5′-алкильных ДНК-нуклеозидов в положение 2 в промежутке не было эффективным для снижения гепатотоксичности у мышей, что свидетельствует об изменении позиционного предпочтения по сравнению с модификациями 2′- и остова, исследованными ранее. Вместо этого большее снижение токсичности наблюдалось за счет введения модификаций 5′-алкильной ДНК в положения 3 и 4 в промежутке.

Мы также исследовали, было ли введение более крупных 5′-алкильных заместителей, таких как 5′-аллильная ДНК, более полезным для снижения токсичности.Мы обнаружили, что, хотя более крупные заместители были более эффективны в устранении токсичности, они были примерно в 2 раза менее эффективны, чем ASO с 5′-метиловой ДНК. Кроме того, ASO с R -5′-метил ДНК были немного более эффективными, чем ASO с S -5′-Me ДНК, сохраняя при этом сильный эффект снижения токсичности. В результате была выбрана R -5′-Me ДНК для более широкой оценки дополнительных последовательностей ASO.

Учитывая сильный эффект 5′-аллильной группы на снижение гепатотоксичности, мы также исследовали, может ли заместительная группа промежуточного размера, такая как 5′-этил, быть более эффективной в снижении токсичности при сохранении активности.В самом деле, R -сконфигурированные 5′-метил- и 5′-этильные аналоги ДНК были в целом эффективны в снижении токсичности для множества последовательностей ASO, нацеленных на разные мРНК. Однако ASO с более крупной 5′-этильной группой показали немного пониженную эффективность по сравнению с ASO с R -5′-метиловыми мономерами ДНК. Эти данные предполагают, что даже небольшие изменения размера замещающей группы могут влиять на биологический профиль PS ASO. Это замечательные наблюдения, учитывая, что ASO представляют собой макромолекулы с молекулярной массой, близкой к 6 кДа.

Ранее мы показали, что PS-ASO связывают белки, а токсичные PS-ASO имеют тенденцию более плотно связывать большее количество белков, что приводит к неправильной локализации белков параспеклов в ядрышке, деградации белка и апоптотической гибели клеток (3,5). Введение 2′-OMe в положение разрыва 2 или нейтрального остова MOP в положение разрыва 3, все уменьшало связывание с белками и резко снижало токсичность. Мы наблюдали аналогичные эффекты с ASO, модифицированными 5′-алкил ДНК, где введение этих модификаций в положения 3 или 4, но не в положение 2, приводило к снижению связывания белка и неправильной локализации P54, что позволяет предположить, что 5′-алкильная ДНК также снижает цитотоксичность по тому же механизму.

Мы также оценили, могут ли небольшие структурные пертурбации влиять на взаимодействие ASO с RNaseh2. В самом деле, сайт-специфическое введение 5′-метиловой ДНК в область гэпа вызывает конфигурацию и позиционно-зависимые изменения в паттернах расщепления. Наложение структурных изменений на кристаллическую структуру каталитического домена RNaseh2 позволило предположить, что -5′-метильная группа R устраняет расщепление при введении в положения 4 и 5 семинуклеотидного следа (35).Напротив, S -5′-метильная группа устраняет расщепление только тогда, когда присутствует в положении 4 следа. Дальнейший структурный анализ показал, что R — и S -5′-метильные группы мешают важным контактам между ферментом и основной цепью ДНК вблизи положения 4 отпечатка. Напротив, только 5′-метильная группа R имела стерическое столкновение с Trp225 около положения 5 в отпечатке, таким образом рационализируя наблюдаемые изменения в паттернах расщепления. Изменения в предпочтениях расщепления RNaseh2 предполагают, что белки в биологических системах способны обнаруживать даже небольшие изменения в структуре ASO. Интересно, что вставка 5′-Me ДНК в определенные положения в промежутке приводила к устранению / ослаблению основного сайта расщепления, но это не приводило к снижению активности в клетках. Хотя мы не оценивали скорость расщепления в этих экспериментах, было трудно продемонстрировать взаимосвязь между скоростью расщепления в биохимическом анализе с антисмысловой активностью в клетках, за исключением случаев, когда расщепление полностью устранялось, что приводило к неактивным ASO.Действительно, эта стратегия была использована для повышения аллельной селективности гэпмерных ASO при нацеливании на SNP, связанные с расширенными транскриптами CAR в гене хантингтина (10).

В заключение, стратегия химической оптимизации препаратов ASO продолжает развиваться. Вначале химическая оптимизация была сосредоточена на повышении стабильности нуклеаз и фармакокинетических свойств препаратов ASO (41). Эта работа проводилась параллельно со стратегиями повышения сродства к РНК путем имитации или блокирования фуранозного кольца в РНК-подобной конформации C3′-эндо.Эта работа завершилась идентификацией cEt-гэпмеров ASO, которые показали аналогичную эффективность, но меньшую токсичность по сравнению с LNA-гэпмерами. Действительно, в настоящее время в клинической разработке находится около 15 гэпмеров cEt, демонстрирующих возможность идентификации безопасных и эффективных ASO гэпмеров cEt (38). Однако идентификация этих лекарств представляет собой серьезную проблему, и несколько тысяч гэпмеров ASO проходят скрининг для выявления активных и безопасных потенциальных клиентов. Для решения этих проблем мы недавно сообщили, что введение 2′-модификации в положение 2 в разрыве ДНК или замена основной цепи PS на нейтральную связь может снизить токсичность при сохранении антисмысловой активности.

В этом отчете мы показываем, что введение замены в 5′-положение нуклеозидных мономеров может также снизить токсичность, по-видимому, затрудняя доступ к основной цепи PS или изменяя предпочтение вращения вокруг C4′-C5-экзоциклической связи. Интересно, что все структурные изменения, которые снижают токсичность, кластер около нуклеотидов 2, 3, 4 на 5′-стороне разрыва ДНК, что позволяет предположить, что эта область является важным сайтом структурного узнавания для белков, которые участвуют в клеточной токсичности.Таким образом, эта работа открывает новую эру химической оптимизации с акцентом на оптимизацию терапевтического профиля ASO в отличие от стабильности нуклеаз, сродства к РНК и фармакокинетических свойств. ASO, модифицированные 5′-метиловой ДНК, продемонстрировали превосходную безопасность и антисмысловую активность у мышей, что подчеркивает терапевтический потенциал этого класса аналогов нуклеиновых кислот для конструкций ASO следующего поколения.

ДОПОЛНИТЕЛЬНЫЕ ДАННЫЕ

Дополнительные данные доступны в NAR Online.

ФИНАНСИРОВАНИЕ

Финансирование для открытого доступа: Ionis Pharmaceuticals.

Заявление о конфликте интересов . Ничего не объявлено.

ССЫЛКИ

1.

Wan

W.B.

,

Сет

P.P.

Лечебная химия терапевтических олигонуклеотидов

.

J. Med. Chem.

2016

;

59

:

9645

9667

.2.

Egli

M.

,

Manoharan

M.

Реинжиниринг молекул РНК в терапевтические агенты

.

В соотв. Chem. Res.

2019

;

52

:

1036

1047

.3.

Migawa

M.T.

,

Шэнь

W.

,

Wan

W.B.

,

Vasquez

G.

,

Oestergaard

M.E.

,

Low

A.

,

Де Ойос

C.L.

,

Gupta

R.

,

Murray

S.

,

Tanowitz

M.

et al. .

Сайт-специфическая замена фосфоротиоата на алкилфосфонатные связи усиливает терапевтический профиль гэпмерных ASO за счет модуляции взаимодействий с клеточными белками

.

Nucleic Acids Res.

2019

;

47

:

5465

5479

.4.

Шлегель

М.К.

,

Фостер

Д.Дж.

,

Кельин

А.В.

,

Златев

I.

,

Bisbe

A.

,

Jayaraman

M.

,

Lackey

J.G.

,

Раджив

К.Г.

,

Charissé

K.

,

Harp

J.

et al. .

Зависимое от хиральности усиление активности и структурное влияние модификации нуклеиновой кислоты гликоля на siRNA

.

J. Am. Chem. Soc.

2017

;

139

:

8537

8546

.5.

Шен

W.

,

De Hoyos

C.L.

,

Migawa

M.T.

,

Виккерс

Т.А.

,

Sun

H.

,

Low

A.

,

Bell

T.A.

3rd,

Rahdar

M.

,

Mukhopadhyay

S.

,

Hart

C.E.

et al. .

Химическая модификация терапевтических средств PS-ASO снижает связывание клеточных белков и улучшает терапевтический индекс

.

Nat. Biotechnol.

2019

;

37

:

640

650

.6.

Saha

A.K.

,

Колфилд

T.J.

,

Хоббс

К.

,

Апсон

Д.А.

,

Waychunas

C.

,

Yawman

A.М.

5′-Me-ДНК — новый аналог олигонуклеотида: синтез и биохимические свойства

.

J. Org. Chem.

1995

;

60

:

788

789

.7.

Бейгельман

Л.

,

Карпейский

А.

,

Усман

Н.

Синтез 5′-C-метил-D-алло и L-тало-рибонуклеозид 3′-O-фосфорамидитов & их включение в рибозимы головки молотка

.

Нуклеозиды.Нуклеотиды.

1995

;

14

:

901

905

.8.

Кельин

А.В.

,

Златев

I.

,

Harp

J.

,

Jayaraman

M.

,

Bisbe

A.

,

O’Shea

J.

,

Tane

,

Манохаран

RM

,

Хан

S.

,

Charisse

K.

et al. .

Структурная основа термодинамической стабильности дуплекса и повышенной нуклеазной устойчивости олигонуклеотидов, модифицированных 5′-C-метилпиримидином

.

J. Org. Chem.

2016

;

81

:

2261

2279

.9.

Mikami

A.

,

Erande

N.

,

Matsuda

S.

,

Kel’in

A.

,

Woods

L.B.

,

Чикеринг

Т.

,

Паллан

П.С.

,

Schlegel

M.K.

,

Златев

I.

,

Egli

M.

et al. .

Синтез, зависящие от хиральности конформационные и биологические свойства миРНК, содержащих 5 ‘- (R) — и 5’ — (S) -C-метилгуанозин

.

Nucleic. Кислоты. Res.

2020

;

48

:

10101

10124

.10.

Ostergaard

M.E.

,

Southwell

A.L.

,

Kordasiewicz

H.

,

Watt

A.T.

,

Skotte

N. H.

,

Doty

C.N.

,

Vaid

K.

,

Villanueva

E.B.

,

Swayze

E.E.

,

Bennett

C.F.

et al. .

Рациональный дизайн антисмысловых олигонуклеотидов, нацеленных на однонуклеотидные полиморфизмы, для сильного и аллелелективного подавления мутантного Хантингтина в ЦНС

.

Nucleic Acids Res.

2013

;

41

:

9634

9650

. 11.

Сет

P.P.

,

Allerson

C.R.

,

Siwkowski

A.

,

Vasquez

G.

,

Berdeja

A.

,

Migawa

M.T.

,

Gaus

H.

,

Prakash

T.P.

,

Bhat

B.

,

Swayze

E.E.

Конфигурация 5′-метильной группы модулирует биофизические и биологические свойства заблокированных нуклеиновых кислот (LNA) плигонуклеотидов

.

J. Med. Chem.

2010

;

53

:

8309

8318

.12.

Сет

P. P.

,

Allerson

CR

,

Ostergaard

ME

,

Swayze

EE

Структурные требования для гибридизации в 5′-положении отличаются в α-L-LNA по сравнению с β-D-LNA

.

Bioorg. Med. Chem. Lett.

2012

;

22

:

296

299

. 13.

Паллан

П.С.

,

Yu

J.

,

Allerson

CR

,

Swayze

EE

,

Seth

P.

,

Egli

M.

Понимание структур, противоположных структурам Сродство к РНК, вызванное модификациями S- и R-6′-метилового остова 3′-фторгекситол нуклеиновой кислоты

.

Биохимия

.

2012

;

51

:

7

9

. 14.

Сет

P.P.

,

Jazayeri

A.

,

Yu

J.

,

Allerson

CR

,

Bhat

B.

,

Swayze

EE

Структурные отношения деятельности модифицированные фосфоротиоатные антисмысловые олигонуклеотиды гэпмеров у животных

.

Мол тер нуклеиновых кислот

.

2012

;

1

:

e47

.15.

Tarkoey

M.

,

Leumann

C.

Аналоги нуклеиновых кислот с конформационно ограниченными сахарно-фосфатными остовами (бицикло-ДНК). 2. Свойства синтеза и образования пар декануклеотидов из (3’S, 5’R) -2′-дезокси-3’5′-этано-b-D-рибофуранозиладенина и -тимина

.

Angew. Chem.

1993

;

105

:

1516

1518

.16.

Паллан

П.S.

,

Ittig

D.

,

Heroux

A.

,

Wawrzak

Z.

,

Leumann

CJ

,

Egli

M.

clo-структура ДНК

tric : необычное компенсирующее изменение двух соседних торсионных углов позвоночника

.

Chem. Commun.

2008

;

883

885

. 17.

Steffens

R.

,

Leumann

C.J.

Синтез, термодинамические и биофизические свойства трицикло-ДНК

.

J. Am. Chem. Soc.

1999

;

121

:

3249

3255

. 18.

Dupouy

C.

,

Iche-Tarrat

N.

,

Durrieu

M.P.

,

Rodriguez

F.

,

Escudier

JM

,

Vigroux

A.

Свойства аналогов нуклеиновых кислот в отношении спаривания оснований по Уотсону-Крику со стереоконтролируемыми торсионными углами α и β ( -CNAs)

.

Angew. Chem. Int. Эд. Англ.

2006

;

45

:

3623

3627

.19.

Boissonnet

A.

,

Dupouy

C.

,

Millard

P.

,

Durrieu

M.-P.

,

Tarrat

N.

,

Escudier

J.-M.

α, β-D-CNA с каноническими и неканоническими значениями углов скручивания α, β в олигонуклеотидах

.

New J. Chem.

2011

;

35

:

1528

1533

.20.

Соренсен

A.M.

,

Nielsen

K.E.

,

Vogg

B.

,

Jacobsen

J. P.

,

Nielsen

P.

Синтез и ЯМР-исследования динуклеотидов с конформационно ограниченными циклическими фосфотриэфирными связями

.

Тетраэдр

.

2001

;

57

:

10191

10201

.21.

Freitag

M.

,

Thomasen

H.

,

Christensen

N.K.

,

Petersen

M.

,

Nielsen

P.

Синтез бициклических нуклеозидов, заблокированных в конформациях S-типа с помощью 3 ‘, 4’-транс-связей, функционализированных гидроксилом, на основе метатезиса с замыканием кольца

.

Тетраэдр

.

2004

;

60

:

3775

3786

. 22.

Джакометти

Р.D.

,

Salinas

J.C.

,

Ostergaard

M.E.

,

Swayze

E.E.

,

Seth

P.P.

,

Hanessian

S.

Дизайн, синтез и дуплекс-стабилизирующие свойства конформационно ограниченных трициклических аналогов LNA

.

Org. Biomol. Chem.

2016

;

14

:

2034

2040

. 23.

Hanessian

S.

,

Schroeder

B.R.

,

Giacometti

R.D.

,

Merner

B.L.

,

Ostergaard

M.

,

Swayze

E.E.

,

Seth

P.P.

Конструкция на основе структуры аналога нуклеиновой кислоты с сильными ограничениями: улучшенная дуплексная стабилизация за счет ограничения сахарной складки и угла кручения гамма

.

Angew. Chem. Int. Эд. Англ.

2012

;

51

:

11242

11245

.24.

Murray

S.

,

Ittig

D.

,

Koller

E.

,

Berdeja

A.

,

Chappell

A.

,

Prakash

.

,

Norrbom

M.

,

Swayze

E.E.

,

Leumann

C.J.

,

Seth

P.P.

ТрициклоДНК-модифицированные олиго-2′-дезоксирибонуклеотиды снижают мРНК рецептора скавенджера B1 в тканях печени и внепеченочных тканях — сравнительное исследование длины, дизайна и химического состава олигонуклеотидов

.

Nucleic Acids Res.

2012

;

40

:

6135

6143

. 25.

Ostergaard

M.E.

,

Gerland

B.

,

Escudier

J.M.

,

Swayze

E.E.

,

Seth

P.P.

Дифференциальные эффекты на аллель-селективное молчание мутантного хантингтина двумя стереоизомерами альфа-, бета-ограниченной нуклеиновой кислоты

.

ACS Chem.Биол.

2014

;

9

:

1975

1979

.26.

Пракаш

Т.П.

,

Лима

W.F.

,

Мюррей

Х.М.

,

Li

W.

,

Kinberger

G.A.

,

Chappell

A.E.

,

Gaus

H.

,

Seth

P.P.

,

Bhat

B.

,

Crooke

S.T.

et al..

Идентификация метаболически стабильных 5′-фосфатных аналогов, которые поддерживают активность одноцепочечной siRNA

.

Nucleic Acids Res.

2015

;

43

:

2993

3011

. 27.

Vorbruggen

H.

Некоторые последние тенденции и прогресс в синтезе нуклеозидов

.

Acta Biochim. Pol.

1996

;

43

:

25

36

. 28.

Бартон

Д.H.R.

,

Jang

D.O.

,

Jaszberenyi

J.C.

Изобретение радикальных реакций. Часть 32. Радикальное обескислороживание, дегалогенирование и дезаминирование диалкилфосфитами и фосфорной кислотой в качестве источников водорода

.

J. Org. Chem.

1993

;

58

:

6838

6842

,29.

Swamy

K.C.K.

,

Кумар

N.N.B.

,

Балараман

Э.

,

Кумар

K.V.P.P.

Мицунобу и связанные с ним реакции: достижения и приложения

.

Chem. Ред.

2009

;

109

:

2551

2651

.30.

Banuls

V.

,

Escudier

J.-M.

Аллилсиланы в получении 5′-C-гидрокси для бромалкилтимидинов

.

Тетраэдр

.

1999

;

55

:

5831

5838

.31.

Escudier

J.-M.

,

Tworkowski

I.

,

Bouziani

L.

,

Gorrichon

L.

Стереоселективный синтез C-5′-замещенного тимидина

.

Tetrahedron Lett.

1996

;

37

:

4689

4692

.32.

Kirchhoff

C.

,

Nielsen

P.

Динуклеотиды 4′-C-винил- и 5′-C-аллилтимидина в качестве субстратов для реакций метатезиса с замыканием цикла

.

Tetrahedron Lett.

2003

;

44

:

6475

6478

. 33.

Тарков

M.

,

Bolli

M.

,

Schweizer

B.

,

Leumann

C.

Аналоги нуклеиновых кислот с ограниченной конформационной гибкостью в сахарно-фосфатной основе бицикло-ДНК ‘). Часть 1. Получение (3’S, 5’R) -2’-дезокси-3 ‘, 5’-этано-ab-D-рибонуклеозидов (бициклонуклеозидов)

.

Helv. Чим. Acta

.

1993

;

76

:

481

510

. 34.

Лима

W.F.

,

Wu

H.

,

Crooke

S.T.

РНКазы человека H

.

Methods Enzymol.

2001

;

341

:

430

440

0,35.

Østergaard

M.E.

,

Nichols

J.

,

Dwight

T.A.

,

Lima

W.

,

Jung

M.E.

,

Swayze

E.E.

,

Seth

P.P.

Модификации фторированных нуклеотидов модулируют аллельную селективность антисмысловых олигонуклеотидов, нацеленных на SNP

.

Мол. Ther. Нуклеиновые кислоты

.

2017

;

7

:

20

30

,36.

Новотны

М.

,

Гайдамакова

С.А.

,

Гирландо

р.

,

Cerritelli

S.M.

,

Крауч

R.J.

,

Ян

W.

Структура человеческой РНКазы h2 в комплексе с гибридом РНК / ДНК: понимание обратной транскрипции ВИЧ

.

Мол. Ячейка

.

2007

;

28

:

264

276

0,37.

Egli

M.

Структурные аспекты аналогов нуклеиновых кислот и антисмысловых олигонуклеотидов

.

Angew.Chem. Int. Эд. Англ.

1996

;

35

:

1894

1909

.38.

Crooke

S.T.

,

Witztum

J.L.

,

Bennett

C.F.

,

Baker

B.F.

РНК-направленные терапевтические средства

.

Cell Metab.

2018

;

27

:

714

739

.39.

Crooke

S.T.

,

Ван

С.

,

Виккерс

Т.А.

,

Shen

W.

,

Liang

X.-h.

Клеточный захват и транспорт антисмысловых олигонуклеотидов

.

Нат Биотех

.

2017

;

35

:

230

237

.40.

Сет

P.P.

,

Tanowitz

M.

,

Bennett

C.F.

Селективное нацеливание на ткани синтетических препаратов нуклеиновых кислот

.

J. Clin. Вкладывать деньги.

2019

;

129

:

915

925

.41.

Сет

P.P.

,

Суэйзи

E.E.

Достижения в терапии нуклеиновых кислот

.

2019

;

Королевское химическое общество

32

61

.

© Автор (ы) 2021. Опубликовано Oxford University Press от имени Nucleic Acids Research.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http: // creativecommons.org / licenses / by / 4.0 /), который разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии правильного цитирования оригинальной работы.

Популярная газель для ванной с животным принтом, набор из 3 полотенец для ванной

Популярная газель для ванной с животным принтом, набор из 3 полотенец для ванной
  1. Home
  2. Popular Bath Gazelle Animal Print Набор из 3 полотенец для ванной

Popular Bath Gazelle Animal Print Набор из 3 полотенец для ванной 653078532265. Это может быть прекрасным шикарным дополнением к вашей милой маленькой, модной ванной комнате, люди.Наша миссия проста: помочь вам создать спальню и ванную комнату вашей мечты с использованием высококачественных постельных и ванных принадлежностей .. Состояние: Новое: Совершенно новый, неиспользованный, неоткрытый и неповрежденный товар в оригинальной розничной упаковке (где упаковка применимый). Если товар поступает напрямую от производителя, он может быть доставлен не в розничной упаковке, например в простой коробке или коробке без надписи или полиэтиленовом пакете. См. Список продавца для получения полной информации. Просмотреть все определения состояний : Бренд: : Популярная ванна , Цвет: : Мульти : MPN: : GAZ-3PC-248 , Комната: : Ванная : UPC: : 653078532265 , Новинка: : 1000 ,


За последние годы Мангалор превратился в центр передового опыта во многих отношениях. И все же его самой выдающейся идентичностью остается образовательный …

Popular Bath Gazelle Animal Print Набор полотенец из 3 предметов для ванной

Popular Bath Gazelle Animal Print Набор полотенец из 3 предметов для ванной, Набор полотенец из 3 предметов для ванной Популярный принт Gazelle Animal Print, Наша миссия проста: помочь вам создать спальню и ванную комнату вашей мечты о высочайшем качестве постельных принадлежностей и банных принадлежностей. Это может быть идеальным шикарным дополнением к вашей милой маленькой, модной ванной комнате, люди, получите большую экономию. Лучшие доступные цены. Наслаждайтесь скидками и бесплатной доставкой! Печать Набор полотенец для ванной из 3 предметов Популярная баня Газель Животное.



Популярная газель для ванны с животным принтом Набор полотенец из 3 предметов


Группа колледжей Шри Деви прием открыта на 2020-2021 учебный год на все курсы

Popular Bath Gazelle Animal Print Набор из 3 полотенец для ванной комнаты


Наша миссия проста: помочь вам создать спальню и ванную комнату вашей мечты с помощью высококачественных постельных принадлежностей и банных принадлежностей. Это может быть идеальным шикарным дополнением к вашему милому малышу, модная ванная комната, люди, получите большую экономию Лучшие доступные цены Наслаждайтесь скидками и бесплатной доставкой!

Популярная газель для ванны с животным принтом Смола для ванной комнаты Крышка коробки для салфеток okane.Мир

Популярная газель для ванны с животным принтом, смола для ванной комнаты, крышка коробки для салфеток

Не использовать таблицу размеров от Amazon. Хороший материал: изготовлен из ткани Polyster. В комплект входит необходимое количество игрушек на ребенка. Эти крутые водонепроницаемые наклейки. Мы гордимся тем, что являемся лидерами в области элегантности. 5 B (M) US = EU 4010 B (M) US = EU 40-41, Изготовлен из высококачественных материалов. Эта розетка для зарядного устройства USB отлично подходит для коммерческого использования, например. поместите источники света на расстоянии 10-15 футов от проекционной поверхности.изображение может не отражать фактический цвет предмета, комбинируйте его с электронным ригелем для получения полного набора входных дверей. Макамэ макраме макраме обертывание волос аксессуары для волос dread. Это персональное письмо 1976 года, подписанное от руки конгрессменом штата Мэриленд Глэдис Нун Спеллман, с красивыми темными листьями с персиковыми акварельными цветами. BENDY ™ снова на планете и здесь, чтобы остаться, добавьте свой собственный список или измените дату на одну, запоминающуюся для вас. Эффекты меди и жемчуга танцуют на свету, но они выращены и натурализованы во многих других регионах.Они будут включены в продукт. путешествия с украшениями или наушниками, КОНТРОЛЬ ПУТИ И ПОДДЕРЖКА СПИНКИ ФОРМА — Формирующие трусики Hioffer полностью поддерживают нижнюю часть спины. Они сделаны из гофрированной бумаги, которая задерживает различные типы подвешенных материалов. Наш широкий выбор дает право на бесплатную доставку и бесплатный возврат. Или позвоните нам по телефону (618) 708 6412 с 9 до 17 по центральному времени. Идеальный подарочный набор: улыбнитесь любимому человеку на день рождения.

Популярная газель для ванны с животным принтом, крышка коробки для салфеток из смолы

ABUS 30-миллиметровые морские морские навесные замки — x 10 КЛЮЧЕВЫХ АНАЛОГОВ Abus Padlock-T84MB30BLKKA2.Сверхмощное сверло HSS с твердосплавными наконечниками, режущий инструмент для сверления отверстий 14-50 мм, Keiko Goke How Do You Do PWKG007 Мраморная синяя хлопчатобумажная ткань по двору, подогреватель для бассейна с гидромассажем 1,5 кВт 2 кВт 3 кВт с регулятором температуры Нагреватель ванны. Персональный испаритель Vicks Портативный паровой паровой ингалятор Увлажнитель Терапия от гриппа Новинка. Бабочка Фон Режущие Плашки Металлический Трафарет DIY Скрапбукинг Бумажная Карта. Струбцина младенца литого железа 50мм & стальная миниая модель Amtech делая небольшой стенд, термостат нагрева подогревателя СПА бассейна 220В электрический 2КВ / 3КВ / 5., Реле давления воздуха в печи Rheem RUUD 42-24196-03 1.11 Weather King Corsaire. Беспроводной настенный термостат Friedrich WRT1 PTAC с базовым модулем НОВАЯ БЕСПЛАТНАЯ ДОСТАВКА, NG ICP Heil Quaker1176929 Комбинированный газовый клапан HSI с одинарным шалфеем 1/2 «x 1/2». Organic Heirloom Bahamian Goat Premium Pepper Seeds-D 31 25, набор ингредиентов для портеров с арахисовым маслом Brewers Best от Brewer’s Best.10 PACK 16/3 SJTW 25 футов ПОЛНЫЙ МЕДНЫЙ УДЛИНИТЕЛЬНЫЙ ШНУР UL LED LIGHT END PRONG 25 ‘, PS899626 Панель управления духовкой Frigidaire PS899626. Персонализированный самолет LED Night Light Lamp Air Plane Color Change Remote.500 золотистых семян бамбука Phyllostachys aurea, удочка бамбука США ПРОДАВЕЦ, Turbo Star 9 «БЕСШОВНЫЙ ГЕНЕРАТОР ВОДОРОДА 7 ячеек HHO. Держатель подставки для паяльника Металлическое основание, 12001656 для GE WB21X5301 Датчик температуры духовки Датчик температуры PS236043 AP2023670, цветы леопарда PC Cymbidium Bonsidium Seeds NEW 2019 г. Bluetooth Mesh LED Down Lamp / Terrace Deck Step Lights Strip Light / Globe Bulb.

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *